ID: 1132517495

View in Genome Browser
Species Human (GRCh38)
Location 16:372599-372621
Sequence CCGGCTCCTTACCCACATGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 98}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132517488_1132517495 0 Left 1132517488 16:372576-372598 CCTGGGCAGCAGTGCCAGCCAGC 0: 1
1: 0
2: 8
3: 59
4: 605
Right 1132517495 16:372599-372621 CCGGCTCCTTACCCACATGGAGG 0: 1
1: 0
2: 0
3: 9
4: 98
1132517484_1132517495 21 Left 1132517484 16:372555-372577 CCAGGCTCTCTTCTCCGAGCACC 0: 1
1: 0
2: 1
3: 21
4: 215
Right 1132517495 16:372599-372621 CCGGCTCCTTACCCACATGGAGG 0: 1
1: 0
2: 0
3: 9
4: 98
1132517487_1132517495 7 Left 1132517487 16:372569-372591 CCGAGCACCTGGGCAGCAGTGCC 0: 1
1: 0
2: 4
3: 27
4: 447
Right 1132517495 16:372599-372621 CCGGCTCCTTACCCACATGGAGG 0: 1
1: 0
2: 0
3: 9
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132517495 Original CRISPR CCGGCTCCTTACCCACATGG AGG Exonic
901614780 1:10529994-10530016 CCAGCTCCTTACCCAGGTGCAGG + Intronic
901762956 1:11482400-11482422 GAGGCTGCTTAGCCACATGGTGG - Intronic
909724368 1:78816192-78816214 CCTGCTTCTTCCCCACTTGGCGG + Intergenic
913597611 1:120393795-120393817 CAGGCTCCCTCACCACATGGTGG - Intergenic
914089719 1:144485519-144485541 CAGGCTCCCTCACCACATGGTGG + Intergenic
914308891 1:146448697-146448719 CAGGCTCCCTCACCACATGGTGG - Intergenic
914512436 1:148345793-148345815 CAGGCTCCCTCACCACATGGTGG + Intergenic
914593218 1:149124434-149124456 CAGGCTCCCTCACCACATGGTGG + Intergenic
919083722 1:192895591-192895613 CCGGGTCCGTTCCCACATTGTGG - Intergenic
1068949533 10:62763194-62763216 TCTGCTCCTAAGCCACATGGTGG - Intergenic
1071569697 10:86690241-86690263 CTGGCTCCTGACCCACTGGGAGG - Intronic
1073873537 10:107894658-107894680 CAGGCTGCTTCCCCTCATGGTGG + Intergenic
1075948188 10:126455470-126455492 CCGCCTGCTTCCCCACAAGGTGG + Intronic
1076680060 10:132167232-132167254 CCGGGTCCTGACCCCCAGGGAGG - Intronic
1081271898 11:41095169-41095191 CAGGCACCTTCCTCACATGGAGG + Intronic
1086361925 11:86068882-86068904 CCGGCTCCTTCCCCGCCTGCCGG + Exonic
1089189049 11:116641163-116641185 CCCCCTCCTGCCCCACATGGAGG + Intergenic
1099969943 12:89490175-89490197 CCAGCTACTTAACCACCTGGTGG + Intronic
1101717332 12:107321851-107321873 CCAGCTCCTTACCCACCTTCTGG + Intronic
1102573621 12:113842613-113842635 CCCGTGCCTTCCCCACATGGGGG - Intronic
1104442697 12:128807431-128807453 ACGTCTCCTTTCCCACAGGGAGG + Intronic
1106431863 13:29688284-29688306 CCGGCACCTGACCATCATGGAGG - Intergenic
1114378616 14:22176440-22176462 CCGGCTCCTTCCACTCATGGTGG - Intergenic
1120934034 14:89875794-89875816 CAGGCTCCACTCCCACATGGAGG - Intronic
1122562982 14:102630299-102630321 CAGGCTGCTTCCACACATGGCGG - Intronic
1123931476 15:25173696-25173718 CTGCCTCCTTTCCCGCATGGAGG + Intergenic
1124227894 15:27911520-27911542 CCGGCTGCTTCCCCTCATAGTGG + Intronic
1132517495 16:372599-372621 CCGGCTCCTTACCCACATGGAGG + Exonic
1132623457 16:879116-879138 GCAGCCCCTCACCCACATGGAGG + Intronic
1132674568 16:1116396-1116418 CCGGCTGCTCACCCCCATGGTGG - Intergenic
1132799564 16:1745204-1745226 CCTGCTCCTGACCCTCATGGTGG - Intronic
1132807115 16:1779942-1779964 CAGGGTCCTTACCCACCGGGTGG - Intronic
1133148246 16:3806816-3806838 CCTGCTCCCTTCCCTCATGGTGG + Intronic
1133229863 16:4361349-4361371 CAGCCTCCTTACCCACAGCGAGG + Exonic
1140820738 16:78660604-78660626 CCAGCTCCCTACTCACTTGGGGG + Intronic
1141444765 16:84050765-84050787 CGCTCTCCTTACCCACATGGGGG - Intergenic
1141444818 16:84051020-84051042 CGCTCTCCTTACCCACATGCGGG - Intergenic
1141444886 16:84051389-84051411 CGCTCTCCTTACCCACATGCGGG - Intergenic
1141444927 16:84051617-84051639 CACTCTCCTTACCCACATGTGGG - Intergenic
1141444966 16:84051816-84051838 CGCTCTCCTTACCCACATGCGGG - Intergenic
1142485864 17:247339-247361 CCTGCTCCTTGCCCAGATGACGG + Intronic
1144012161 17:11159440-11159462 CCGGCTCCTTCCACTCATGGTGG - Intergenic
1144578286 17:16443608-16443630 CAGTCTCCTTGCCCTCATGGTGG + Exonic
1146829693 17:36057842-36057864 CCACCTCCTTACACCCATGGGGG + Intergenic
1151317187 17:73330181-73330203 CCGGGTCCTTACCCACAATCTGG + Intergenic
1151537786 17:74748586-74748608 CCGGCTCCTTACCCCGGGGGCGG - Intergenic
1152471667 17:80492953-80492975 CCTGCTCCATAGCCACACGGGGG - Intergenic
1152680679 17:81666398-81666420 CCGGCTCCGTCCCCACATGCGGG + Exonic
1153513170 18:5877684-5877706 CAGCCTCCTTACCCACACTGTGG - Intergenic
1153841572 18:9012730-9012752 CAGGCTGCTTCCACACATGGTGG + Intergenic
1160753268 19:745253-745275 CCTGCTCCTTCCCCGCATCGGGG - Intronic
1160846383 19:1167977-1167999 GCGGCTCCTGCCCCACTTGGAGG - Intronic
1168415048 19:56162393-56162415 CCGTCTTCTTCCCCACACGGTGG - Intergenic
925923231 2:8652165-8652187 CAGGCTGCTTCCCCTCATGGCGG + Intergenic
928977660 2:37105500-37105522 CCGGCTGCTTCCACTCATGGTGG - Exonic
929668527 2:43852089-43852111 ATGGCTCTCTACCCACATGGAGG - Intronic
934685211 2:96316221-96316243 CCCCCTCCTCATCCACATGGAGG + Intergenic
941447928 2:165625272-165625294 CTGTCTCCTTACCCAAATGTTGG - Intronic
945062719 2:205923227-205923249 CTGGCTCCTCACCAGCATGGCGG + Intergenic
946127688 2:217578356-217578378 CAGGCTCCTCACCTAAATGGTGG + Intronic
947432755 2:230045131-230045153 CGGGCTCCTTACCCATTTGAAGG - Intronic
948853501 2:240719600-240719622 GCTGCCCCTGACCCACATGGAGG - Intronic
1170547226 20:17444824-17444846 CCAGCTCCTTTCCCACAGGGTGG - Intronic
1170849866 20:19995062-19995084 GTGGCTCCTGATCCACATGGAGG + Intronic
1173440608 20:43071857-43071879 ACGGCTTCTTTCCCACAGGGAGG + Intronic
1173787291 20:45803442-45803464 CCTGCCCCTTTCCCTCATGGTGG - Intronic
1174368311 20:50069651-50069673 CTGGCTCCTAACCCAGAGGGAGG + Intergenic
1177222858 21:18217365-18217387 ACAGATCCTTACCCACATGATGG + Intronic
1180748605 22:18109911-18109933 CCAGCCCCTCACCCACCTGGGGG + Intronic
1184197181 22:42937720-42937742 CCTGCTCCTCACCCACAGTGGGG - Intronic
1184282820 22:43448293-43448315 AGTGCTCCATACCCACATGGGGG - Intronic
1185229875 22:49673702-49673724 CCGGCTCCTTTCCTCCATGGGGG - Intergenic
949260477 3:2098759-2098781 CCGGCTCCTTAGCCGCGGGGCGG - Intergenic
950424914 3:12919913-12919935 CCGGCTCCCTGCCCTCAGGGAGG - Intronic
953979547 3:47406814-47406836 CCCGCTCCTTACACACCAGGGGG + Intronic
955551307 3:60088038-60088060 CTGGCTGCTTACACTCATGGTGG + Intronic
955814734 3:62829996-62830018 CCACCCACTTACCCACATGGTGG - Intronic
968944275 4:3655378-3655400 CGGGCTCCTTATCCAGCTGGGGG - Intergenic
979462933 4:121003956-121003978 CCTTCTCTTCACCCACATGGTGG - Intergenic
980212937 4:129813726-129813748 CAGGCTGCTTCCCCTCATGGTGG + Intergenic
997990658 5:138542622-138542644 CGGGCCCCTTACCCCCATGCGGG + Intronic
1000483958 5:161815707-161815729 CCCGCTTCCTCCCCACATGGTGG + Intergenic
1001117280 5:168950212-168950234 CCAGCTACTTCCTCACATGGAGG - Intronic
1002434378 5:179221882-179221904 CCTGCTCCTCAGCCCCATGGGGG - Intronic
1002459497 5:179365978-179366000 CCGGCTGCTTCCACTCATGGAGG - Intergenic
1012682120 6:102195381-102195403 CTGGCACCTTACAAACATGGTGG - Intergenic
1013010118 6:106112839-106112861 TCTGCTCCTTACCCACAATGGGG - Intergenic
1018802398 6:167234688-167234710 CCGGCTCTGTTCCCACAGGGTGG - Intergenic
1018808389 6:167278808-167278830 CCGGCTCTGTTCCCACAGGGTGG + Intronic
1019756944 7:2777615-2777637 CCTGCTGCTTCCTCACATGGTGG - Intronic
1022507819 7:30917473-30917495 CCTGCTGCTTTCTCACATGGGGG + Intronic
1026506573 7:70989582-70989604 CAGGCTGCTTGCCCTCATGGTGG - Intergenic
1029260275 7:99297570-99297592 CCTGCTTCTTACCCCAATGGAGG + Intergenic
1034194824 7:149238603-149238625 CTGGCTCCTTCCTCACATGCAGG - Intergenic
1037393750 8:18420690-18420712 CAGGCTGCTTCCACACATGGTGG - Intergenic
1040595361 8:48832866-48832888 ATGGCACCTTACCAACATGGAGG - Intergenic
1044115203 8:88327299-88327321 CAGGCTCCTTACCCACCCGGAGG - Exonic
1047519355 8:125582660-125582682 CCAGCCCCTTAGCCACAAGGAGG - Intergenic
1052119373 9:24692037-24692059 CCTGGTTCTTACACACATGGTGG + Intergenic
1053055765 9:34992278-34992300 CCGGATCCTAAACCACAGGGTGG + Intronic
1056763248 9:89429094-89429116 CCAGCTCCTTCCCCAAATGCAGG + Intronic
1057337450 9:94166658-94166680 CCAGCTCCTCACCGACAGGGCGG + Intergenic
1058808644 9:108617599-108617621 CAGGCTGCTTCCCCTCATGGTGG - Intergenic
1060933495 9:127503277-127503299 CCTGCTCCCTTCCCACATGCAGG - Exonic
1188295350 X:28440762-28440784 CAGGCTGCTTCCACACATGGTGG - Intergenic
1189139412 X:38585877-38585899 CAGGCTACTTCCACACATGGTGG - Intronic
1192840551 X:74850382-74850404 CTGGCACCTGAGCCACATGGAGG + Intronic
1200234102 X:154459953-154459975 CTGGCTCCTTTCCAGCATGGGGG + Intronic