ID: 1132518098

View in Genome Browser
Species Human (GRCh38)
Location 16:375265-375287
Sequence GAGCCAGAGGGCCCCATCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 201}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132518095_1132518098 -3 Left 1132518095 16:375245-375267 CCTGGAAGAAGGCTGCAGGGGAG 0: 1
1: 0
2: 6
3: 70
4: 462
Right 1132518098 16:375265-375287 GAGCCAGAGGGCCCCATCAGAGG 0: 1
1: 0
2: 3
3: 24
4: 201
1132518094_1132518098 -2 Left 1132518094 16:375244-375266 CCCTGGAAGAAGGCTGCAGGGGA 0: 1
1: 0
2: 1
3: 70
4: 401
Right 1132518098 16:375265-375287 GAGCCAGAGGGCCCCATCAGAGG 0: 1
1: 0
2: 3
3: 24
4: 201
1132518088_1132518098 23 Left 1132518088 16:375219-375241 CCAGGCGCTCAGAGACAAAGGGT 0: 1
1: 0
2: 0
3: 3
4: 112
Right 1132518098 16:375265-375287 GAGCCAGAGGGCCCCATCAGAGG 0: 1
1: 0
2: 3
3: 24
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132518098 Original CRISPR GAGCCAGAGGGCCCCATCAG AGG Intronic
900142517 1:1144656-1144678 CAGCCACAGGGCCCCAGCAACGG + Intergenic
900145915 1:1158605-1158627 GAGCCACTGGGCCCCCTCCGTGG + Intergenic
900477218 1:2881648-2881670 TGGCCAGAGGGCCCCGGCAGTGG - Intergenic
901052056 1:6430151-6430173 AGGACACAGGGCCCCATCAGGGG + Intronic
901678051 1:10898321-10898343 GGGTCAGAGGGCCCCCTCAAGGG + Intergenic
902491127 1:16781471-16781493 GAGTCAGAGGGTTCCAGCAGAGG + Intronic
902581426 1:17410151-17410173 GGGCCAGAGGGCATCATCACTGG - Intronic
902606755 1:17573393-17573415 GAGCCACGGTGCCCCATCACAGG + Intronic
903529647 1:24020424-24020446 GAGGCTGAGGGCCTCTTCAGGGG + Intergenic
904795796 1:33055514-33055536 GAGCCAGAGGCCACCAGCAGAGG - Intronic
904813477 1:33179265-33179287 GAGGATGAAGGCCCCATCAGAGG - Intronic
904875829 1:33653790-33653812 AAACCACAGGGCACCATCAGAGG + Intronic
905513371 1:38542315-38542337 GAGCCAGAAGTGCCCTTCAGAGG + Intergenic
905856216 1:41316507-41316529 GAGAGTGAGTGCCCCATCAGTGG + Intergenic
906085478 1:43129690-43129712 GAGGCAGAGGGACCCAGGAGTGG - Intergenic
906779317 1:48558309-48558331 GAGCAAGAGGGCACCAAAAGTGG + Intronic
907290223 1:53408681-53408703 GAGCTAGTGGACCCCATGAGGGG + Intergenic
907640015 1:56179072-56179094 GAGCCAGTGTGCACCATCATTGG - Intergenic
911238405 1:95437295-95437317 GAGACAGGGGGCCCCAGCAGGGG - Intergenic
912321288 1:108716032-108716054 GAGCCCGCGGGCCCCATGACAGG + Intronic
914921929 1:151853138-151853160 CAGACAGAGGACCCCATCTGTGG - Intronic
915590156 1:156866237-156866259 GAGGCAGAGGGTCCCAGCAGCGG + Intronic
918131145 1:181630864-181630886 CAGCCAGAGGTCTCCAACAGAGG + Intronic
922423091 1:225472208-225472230 GAGCCAGTGCTGCCCATCAGAGG - Intergenic
923529316 1:234801063-234801085 GAGTCAGAGGGTTCCAGCAGAGG - Intergenic
1063378733 10:5570811-5570833 TAGACAGAGGTCCCCATCAAGGG + Intergenic
1063472267 10:6297599-6297621 GAGCAAGATGTCCCCATGAGGGG + Intergenic
1063665698 10:8058908-8058930 CACCCAGAGGGACCCCTCAGGGG + Intronic
1067142531 10:43669088-43669110 GGGCCAGAAGGAGCCATCAGAGG + Intergenic
1070559506 10:77555216-77555238 GAGTCAGACGGCCCCCTCACAGG + Intronic
1075170146 10:120105723-120105745 GAGACAGTGGGCCCCATTTGTGG + Intergenic
1076755972 10:132571958-132571980 GAGACAGAGGGGCACAGCAGTGG - Intronic
1077037521 11:502578-502600 GAGCCTGGAGGCCCCAGCAGGGG + Exonic
1077185007 11:1231943-1231965 GAGCCAGGTGGGCCCAACAGTGG + Intronic
1079153552 11:17923358-17923380 GTGCCAGAGGGCCCAATCCTGGG + Intronic
1079241294 11:18724022-18724044 GCTCCAGAGGGGCCCATTAGTGG + Intronic
1079248994 11:18773505-18773527 GACCCAGAGGGGCTCTTCAGTGG + Intronic
1083263354 11:61535131-61535153 GAGGCCGAGGGGCCCATCACCGG + Intronic
1083855674 11:65391991-65392013 GAGCATGAGGACCCCATGAGGGG + Intronic
1084096217 11:66913233-66913255 GAGCTAGAGGGCCCAATGGGTGG + Intronic
1085532066 11:77197813-77197835 GAGCCAGGGGCCCCCGTCAGTGG + Intronic
1086349491 11:85931234-85931256 GAGCCAGATGGCCCTCTCGGAGG - Intergenic
1086446265 11:86874199-86874221 GAGCCAGAGTCACCTATCAGAGG + Intronic
1088271703 11:108041069-108041091 GAGCCAAAGTCACCCATCAGAGG - Intronic
1088669701 11:112129078-112129100 GAGCCAGAGGGCAACATCTGTGG - Intronic
1089376811 11:118000317-118000339 GTGCCAGAGGTACCCACCAGAGG - Exonic
1089933035 11:122333659-122333681 GTACCAGAGGGCCTCACCAGTGG + Intergenic
1091593788 12:1861273-1861295 GAGCCAGAGGGCATGACCAGGGG - Intronic
1092970270 12:13687068-13687090 CAGACTGAGGCCCCCATCAGAGG + Intronic
1093530829 12:20161081-20161103 GAGACAGAGTGCCTCGTCAGTGG - Intergenic
1094845004 12:34357634-34357656 GAGGCAGAGGTCCCCATCACCGG - Intergenic
1094851517 12:34384371-34384393 GAGGCAGAGGTCCCCCTCACGGG - Intergenic
1094853616 12:34393281-34393303 GAGGCAGAGGTCCCCACCATGGG + Intergenic
1096270947 12:50166378-50166400 GAGCCACAGGGCTTTATCAGAGG - Intronic
1102442327 12:112972761-112972783 GAGCCAGAGGGCCTCCTTGGTGG + Exonic
1103014299 12:117481943-117481965 GATCCACAGGGTCCCCTCAGGGG - Intronic
1104038234 12:125113330-125113352 GAGCCAGAGGCTCACATCTGTGG + Intronic
1105214137 13:18274486-18274508 GAGCCAGAGGGACCCAGCCTGGG - Intergenic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1106776938 13:33017296-33017318 GAGACAGAGGGCCTCCACAGGGG + Intronic
1108432426 13:50367649-50367671 CAGTCAGAAGGCACCATCAGTGG - Intronic
1112562407 13:100526192-100526214 AATGCAGAGGCCCCCATCAGGGG - Intronic
1112829852 13:103436332-103436354 GAGCCAAAGATTCCCATCAGAGG + Intergenic
1117386957 14:55224984-55225006 GAGCCAGAGTGCCTCAACTGTGG - Intergenic
1118738550 14:68720994-68721016 GCTCCAGGGGGCCCCATCAAGGG + Intronic
1119668380 14:76500273-76500295 GAGCCGGAGGGACACATCACTGG - Intronic
1121271832 14:92642728-92642750 CACTCAGAGGGGCCCATCAGGGG + Intronic
1122012241 14:98759735-98759757 GTGGCAGATGGCTCCATCAGAGG - Intergenic
1122029740 14:98903432-98903454 GAGCCAGGGCTTCCCATCAGAGG - Intergenic
1123048598 14:105530114-105530136 GAGCCAGAGGCCCCCACCGAAGG - Exonic
1123061451 14:105596569-105596591 GAGCCAAAGTGCCCAAGCAGTGG - Intergenic
1123068630 14:105630373-105630395 GAGCCAGAGGGGCCCATTCAGGG + Intergenic
1123085904 14:105717480-105717502 GAGCCAAAGTGCCCAAGCAGTGG - Intergenic
1123092653 14:105748700-105748722 GAGCCAGAGGGGCCCATTCAGGG + Intergenic
1123098213 14:105776401-105776423 GAGCCAGAGGGGCCCATTCAGGG + Intergenic
1124356652 15:29000477-29000499 GAGCAAGACGGCTGCATCAGAGG - Intronic
1125326726 15:38542731-38542753 GAGCCAGAGGGTCCCAATAATGG + Intronic
1126066131 15:44827666-44827688 CAGCCAGAGGGCCCCAGCAGGGG + Intergenic
1126093705 15:45072898-45072920 CAGCCAGAGGGCCCCAGCAGGGG - Intronic
1128739807 15:70075904-70075926 GAGGCAGGGGGCCATATCAGAGG - Intronic
1129341372 15:74888687-74888709 GAGCCAGAGGACCCCAGGGGAGG + Intergenic
1129662980 15:77563523-77563545 GACCCAGAGGGCCTCACTAGGGG + Intergenic
1129709846 15:77815191-77815213 GGGCCATATGGCCACATCAGGGG - Intronic
1132518098 16:375265-375287 GAGCCAGAGGGCCCCATCAGAGG + Intronic
1134343694 16:13369623-13369645 AAGACGGAGAGCCCCATCAGTGG - Intergenic
1135947460 16:26877530-26877552 GGACCAGAGGGACCCATCTGGGG - Intergenic
1136412672 16:30086201-30086223 GAGGCAGAGGGGCCCAGCAGTGG + Exonic
1138417445 16:56879479-56879501 GAGCCAGGAGCCCCCATCTGTGG - Intronic
1138708502 16:58942259-58942281 GAACTAGACGGCCCCATCTGGGG - Intergenic
1139550485 16:67670099-67670121 TAGCCAGAGGGCCCCTTAAAAGG + Intergenic
1140965909 16:79965754-79965776 GAGCCAGAAGACCCCATCTGGGG - Intergenic
1141658421 16:85428644-85428666 CAGCCAGGTGTCCCCATCAGAGG - Intergenic
1142509190 17:384015-384037 GGGCGAGAGGGCCCAACCAGGGG + Intronic
1142682672 17:1559555-1559577 GACCCAGAGGGCTCCAGCAAGGG - Intronic
1143717654 17:8786335-8786357 GAGCCAGAGGGGGCAATCTGTGG - Intergenic
1144057991 17:11558707-11558729 GGGCCAGCGGGTCCAATCAGTGG + Exonic
1144852791 17:18252393-18252415 GAGCAAGGGGGACCCAGCAGAGG - Intronic
1146946145 17:36874910-36874932 GAGACAGAGGGCCTCAGCAGCGG - Intergenic
1147047786 17:37767626-37767648 GAGCCAGGAGGCCCCATGGGGGG - Intergenic
1147638244 17:41977162-41977184 GAGTCAGAGGGGCCCATGAGCGG - Exonic
1147876227 17:43622541-43622563 GAGCCAGACTGACCCTTCAGGGG + Intergenic
1148438025 17:47697058-47697080 GGCCCAGAGGGCCCCACCACAGG - Intronic
1148497267 17:48060308-48060330 GAGCCACTGGGCCCCAACACTGG + Exonic
1148688072 17:49511940-49511962 GAACCAGACGCCCCCACCAGAGG + Exonic
1148947754 17:51280041-51280063 GAGCAAGAAGGACCCATCTGGGG - Exonic
1150305923 17:64085291-64085313 CAGCCAGAAGCCCTCATCAGAGG - Intronic
1150484829 17:65536472-65536494 GAGCCAGCCGGCACCATCTGTGG - Exonic
1151092710 17:71461124-71461146 CAGCCAGAGGGCGCCATCGAAGG - Intergenic
1151575178 17:74949575-74949597 GAGCCAGAGGCCAACAGCAGGGG + Exonic
1151654311 17:75488711-75488733 GAACGAGAGGGTCCTATCAGAGG - Intronic
1151696872 17:75722297-75722319 CAGCCAGAGGGCCACCCCAGAGG - Intronic
1152070311 17:78130966-78130988 TAGCCACAGGTCCTCATCAGGGG + Intronic
1152383428 17:79954453-79954475 GAGCCCAGGGGCCCCAGCAGTGG - Intronic
1152740246 17:82015562-82015584 GGGCGAGAGGGCTCCCTCAGAGG - Intronic
1155300252 18:24422629-24422651 GAGCCCAAGCACCCCATCAGAGG + Intergenic
1155448661 18:25940932-25940954 GAGACAGAGGACCCCAAAAGTGG + Intergenic
1157243073 18:46029254-46029276 GAGCAAGAAGGACCCATCTGGGG - Intronic
1158282011 18:55838643-55838665 AAGCCAGAGGGCTCAGTCAGAGG + Intergenic
1160152813 18:76407784-76407806 GAGCCCATGGGCCCCATGAGGGG - Intronic
1161217751 19:3102950-3102972 GAGCCACAGGGCCCCACCTGGGG - Intronic
1161284165 19:3460190-3460212 GAGCAAGAGGGGGCCATCCGGGG + Intronic
1161539968 19:4844654-4844676 AAGCCAGAGGTACCCATGAGGGG - Exonic
1161727932 19:5941125-5941147 AAGCCAGGAGGCCCCAGCAGAGG - Intronic
1161960865 19:7522499-7522521 GACCCAGAGGGCGCCGGCAGAGG + Intergenic
1163402985 19:17105605-17105627 GATCCTGAGAGCCCCCTCAGTGG + Intronic
1164504092 19:28843855-28843877 GAGCCAGAGGCCCGGATCAGAGG - Intergenic
1165331472 19:35143091-35143113 GCGCCACTGGGCCCCAGCAGGGG + Intronic
1165957930 19:39513621-39513643 GAGCCACCGCTCCCCATCAGGGG + Intergenic
1166582076 19:43909841-43909863 CAGCCAGAGGTTCCCTTCAGAGG - Intergenic
925999172 2:9316524-9316546 AAGCCACAGGGGCCCAGCAGTGG + Intronic
928101391 2:28439579-28439601 GAGGCAGAGGGCCTCATCAGCGG + Intergenic
929121713 2:38489238-38489260 GAGCCAGAGGGGCCTCTCTGGGG - Intergenic
930534863 2:52632729-52632751 CAGCAAGAGGGCGCCAGCAGAGG - Intergenic
931665167 2:64605328-64605350 GAGCCAGAGGGCCCGGGCAGAGG + Intergenic
932417717 2:71583880-71583902 GAGCCACAGGGCTCCCCCAGGGG - Intronic
932749990 2:74365452-74365474 GAGGCAGAGAGCTCCAGCAGTGG + Intronic
933162416 2:79040124-79040146 GCGGTAGAGGGCACCATCAGAGG - Intergenic
934300183 2:91772264-91772286 GAGCCAGAGGGACCCAGCCTGGG + Intergenic
936451914 2:112640271-112640293 GGGCTAGAGGGTCCCATCATTGG + Intergenic
937312064 2:120908638-120908660 GAGCCAGGGGGCCCAAGCAGTGG - Intronic
946304940 2:218851121-218851143 GAGCCACAGGTACCCAGCAGGGG - Intergenic
947665449 2:231902670-231902692 GAGCCAGATGAGTCCATCAGAGG - Intergenic
947723434 2:232382337-232382359 GAGGCAGAGGGCCCCCTGGGGGG - Exonic
947899976 2:233713095-233713117 GAGCCAGTGGCTGCCATCAGTGG - Exonic
947900676 2:233718924-233718946 GAGCCAGGGGCTGCCATCAGTGG - Exonic
948002604 2:234580521-234580543 GAGCCAGAGGGTCCCAGCACAGG + Intergenic
948692099 2:239712463-239712485 GAGCCAGAGGCAACCATGAGTGG + Intergenic
948757741 2:240169077-240169099 CATCCACAGGACCCCATCAGAGG - Intergenic
1168849584 20:967354-967376 GACCCAGTGGGCCCCATCCTTGG - Intronic
1169406547 20:5326191-5326213 AAGTCAGGGGGCCCCATCAGTGG + Intergenic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1171472218 20:25381238-25381260 CAGCCACAGGGCCTCATCTGCGG + Intronic
1172217746 20:33248272-33248294 GAGTTAGGGGGCCCCATCTGGGG + Intergenic
1172480892 20:35270725-35270747 GAGTCAGAGGGCCTCAGAAGTGG + Intronic
1173003582 20:39123103-39123125 GAGGCAAAGGGACCCCTCAGGGG + Intergenic
1174346869 20:49936636-49936658 GAGCCAGAGGACCCACCCAGAGG + Intronic
1174536400 20:51254740-51254762 GAACCAGAAGGCCCCATGGGAGG + Intergenic
1175756515 20:61533589-61533611 CAGCCAGAGGGGCCCCTCATGGG - Intronic
1176058295 20:63160527-63160549 TAGCCTGAGGCCCCCAACAGTGG - Intergenic
1178429725 21:32508719-32508741 CAGCAATAGGGCCCCAACAGGGG + Intronic
1180972256 22:19821786-19821808 GAGCCAGAGGGCACAGCCAGTGG - Intronic
1181367212 22:22387267-22387289 GAGCCAGATGGCCCTCTCGGTGG - Intergenic
1182556658 22:31133059-31133081 GGGGCAGGGGGCCACATCAGGGG - Intronic
1182852930 22:33491943-33491965 GAGCCATAAGGCCACATCAAGGG - Intronic
1183671879 22:39277945-39277967 TAGCAAAAGGGCTCCATCAGTGG + Intergenic
1184313562 22:43664843-43664865 CAGCCAGAGCGACCCCTCAGTGG - Intronic
1184561687 22:45267619-45267641 GAGCCACCGGGCCCCGCCAGGGG + Intergenic
1185388222 22:50546262-50546284 GAGCCAGATGGTCCCCTCTGGGG + Intergenic
951267769 3:20589468-20589490 GAGCCAGATGGCCCTCTCGGGGG - Intergenic
953842633 3:46401535-46401557 GTGCCAAAGGCACCCATCAGAGG + Intergenic
954380175 3:50215166-50215188 GACCCAGAGGGCCCCTTCTGGGG + Intronic
961660831 3:128468030-128468052 GAGCCAGTGGGGAGCATCAGGGG + Intergenic
962215621 3:133518533-133518555 GACCCACAGGAACCCATCAGAGG - Intergenic
963543911 3:146631109-146631131 GAGCCAAAGCCACCCATCAGAGG + Intergenic
967347976 3:188479951-188479973 GAAACAAAGGCCCCCATCAGAGG - Intronic
968417671 4:454151-454173 TATCCAGAGGGCCCCCCCAGGGG - Intronic
969043879 4:4322584-4322606 GAGCCAGAGGAGGCCATGAGAGG - Intergenic
969602614 4:8185884-8185906 GTGCCAGTGGGGCCCATCTGAGG - Intronic
971275717 4:25194701-25194723 GAGCCAGAGGGCACCAGTACAGG - Intronic
972083996 4:35190509-35190531 GAGCCAGATGGCCCTCTCTGGGG + Intergenic
980343250 4:131579208-131579230 GAGCCATATGGGCCCCTCAGAGG - Intergenic
981041424 4:140226055-140226077 GAGCCATAGGGCCCCAACCCAGG - Intergenic
983425219 4:167575162-167575184 GAGCCAGATGGCCCTCTCATGGG + Intergenic
984731097 4:183068971-183068993 GAGCCAAAGGTGCCCATCAGAGG + Intergenic
986051929 5:4098309-4098331 GAGAAGGAAGGCCCCATCAGTGG - Intergenic
986250828 5:6057161-6057183 GAGCCACTGTGCCCCATCATAGG - Intergenic
988132355 5:27121180-27121202 GAGCCAGATGGCCCCCTCTGGGG + Intergenic
991436829 5:66604828-66604850 GGGCCTCAGGGCCTCATCAGTGG + Intronic
991665830 5:68999054-68999076 GAGTCAGAGAGCCACATCACTGG + Intergenic
992214662 5:74514363-74514385 GAGCCAAAGTGCCCAATCAGGGG + Intergenic
995240026 5:109875164-109875186 GAGCAAGAGGGTCACATTAGTGG + Intergenic
995930597 5:117437557-117437579 CAGCCATAGGCCCTCATCAGAGG + Intergenic
998107233 5:139476301-139476323 GAGCCTGAGCTCCTCATCAGTGG - Exonic
999102502 5:149037962-149037984 TAACCACAGGGCCCCTTCAGAGG - Intronic
1001571396 5:172732685-172732707 GGGGAAGAGGGGCCCATCAGTGG + Intergenic
1003060026 6:2855709-2855731 GAGCCTTAGGGCCCCAGCATTGG + Intergenic
1007063723 6:38968323-38968345 GCTTCAGAGGGCACCATCAGAGG + Intronic
1008152625 6:47973523-47973545 GAGCCAGACGGCACCAACAGGGG + Intronic
1008535207 6:52502205-52502227 GAGCCAGCCAGCCCCGTCAGGGG - Exonic
1010383945 6:75257073-75257095 GACCCATAGGGACCCATCTGTGG - Intronic
1012416450 6:99018832-99018854 GTGCGAGATGACCCCATCAGAGG - Intergenic
1018059449 6:160079087-160079109 CAGGCAGAGGGCTCCATCACAGG - Intronic
1019595459 7:1856389-1856411 GAGGCAGGGGGCCCCCACAGAGG - Intronic
1023696946 7:42857250-42857272 CAGCCAGAGGGCCCCTTCCTGGG - Intergenic
1023995784 7:45158097-45158119 GAGGCACAGGGCCCCCTCCGGGG + Intronic
1029425796 7:100493496-100493518 CAGCCAGAGGGAGCCAGCAGAGG + Intronic
1032464170 7:132133466-132133488 GAGCCAGAGGGTCCCAACTCGGG + Intronic
1039792787 8:40888760-40888782 GACCCAGAGGGCCACCTCGGGGG + Intronic
1042558304 8:70052475-70052497 TAGCCAGAAGGACACATCAGTGG - Intronic
1043527405 8:81111878-81111900 GAGCCAGAGACACCCACCAGGGG - Exonic
1051348559 9:16175608-16175630 GGGTCAGGTGGCCCCATCAGAGG - Intergenic
1060208228 9:121694956-121694978 GAGGCAGAGTGCCCCATCTGGGG + Intronic
1061510863 9:131060113-131060135 GAGCCAGAGGGCAGGAACAGGGG + Intronic
1061847121 9:133394096-133394118 GAGGAAGAGGCCCCAATCAGCGG - Intronic
1062130449 9:134889842-134889864 GAGGCAGCGGTCCCCAGCAGAGG - Intergenic
1062284864 9:135768373-135768395 GAGTCACAGTGCCCCCTCAGTGG - Intronic
1062695980 9:137876852-137876874 CAGCCCGAGGGACCCTTCAGAGG + Intergenic
1186370463 X:8941259-8941281 GAGCCAGAGAAGGCCATCAGAGG - Intergenic
1186908013 X:14132164-14132186 GAGCCAGAGGCAGCCTTCAGTGG + Intergenic
1188939146 X:36215859-36215881 GAGCCAGATGGCCCTCTCCGGGG + Intergenic
1189577944 X:42375416-42375438 GAGGCAGAGTGCCCCATCTGGGG - Intergenic
1189671496 X:43414999-43415021 GAGGCTGAGGGCCCCATGATGGG + Intergenic
1189977033 X:46472097-46472119 AAACCAGTGGGCCCCAGCAGTGG - Intronic
1190947698 X:55111800-55111822 GAGCCAGATGGCCCTATGGGGGG + Intronic
1191253951 X:58271831-58271853 GAGGCTGAGTGCCCCACCAGAGG - Intergenic
1193317227 X:80077748-80077770 CAGCCAGAGAGCCCCAGCAGTGG + Intergenic
1198718366 X:139587296-139587318 CAGCAAGAGGTCCCCATCAAGGG + Intronic
1201077842 Y:10200322-10200344 GAGCCTGGGGGCACCCTCAGGGG - Intergenic
1201628542 Y:16042491-16042513 GAGCCAGCTGGCCCACTCAGTGG - Intergenic