ID: 1132518599

View in Genome Browser
Species Human (GRCh38)
Location 16:377288-377310
Sequence GAGCGAGGACCACCCCAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 75}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132518594_1132518599 1 Left 1132518594 16:377264-377286 CCCCAGAGTGCAGCGTGGAGCCT 0: 1
1: 0
2: 0
3: 25
4: 187
Right 1132518599 16:377288-377310 GAGCGAGGACCACCCCAAAGAGG 0: 1
1: 0
2: 0
3: 2
4: 75
1132518587_1132518599 28 Left 1132518587 16:377237-377259 CCCCCGGCATGCAGGGAGCAGGG 0: 1
1: 1
2: 3
3: 31
4: 331
Right 1132518599 16:377288-377310 GAGCGAGGACCACCCCAAAGAGG 0: 1
1: 0
2: 0
3: 2
4: 75
1132518596_1132518599 -1 Left 1132518596 16:377266-377288 CCAGAGTGCAGCGTGGAGCCTAG 0: 1
1: 0
2: 0
3: 22
4: 106
Right 1132518599 16:377288-377310 GAGCGAGGACCACCCCAAAGAGG 0: 1
1: 0
2: 0
3: 2
4: 75
1132518590_1132518599 26 Left 1132518590 16:377239-377261 CCCGGCATGCAGGGAGCAGGGCT 0: 1
1: 0
2: 5
3: 96
4: 557
Right 1132518599 16:377288-377310 GAGCGAGGACCACCCCAAAGAGG 0: 1
1: 0
2: 0
3: 2
4: 75
1132518589_1132518599 27 Left 1132518589 16:377238-377260 CCCCGGCATGCAGGGAGCAGGGC 0: 1
1: 0
2: 0
3: 22
4: 293
Right 1132518599 16:377288-377310 GAGCGAGGACCACCCCAAAGAGG 0: 1
1: 0
2: 0
3: 2
4: 75
1132518595_1132518599 0 Left 1132518595 16:377265-377287 CCCAGAGTGCAGCGTGGAGCCTA 0: 1
1: 0
2: 0
3: 2
4: 86
Right 1132518599 16:377288-377310 GAGCGAGGACCACCCCAAAGAGG 0: 1
1: 0
2: 0
3: 2
4: 75
1132518591_1132518599 25 Left 1132518591 16:377240-377262 CCGGCATGCAGGGAGCAGGGCTG 0: 1
1: 0
2: 6
3: 49
4: 502
Right 1132518599 16:377288-377310 GAGCGAGGACCACCCCAAAGAGG 0: 1
1: 0
2: 0
3: 2
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132518599 Original CRISPR GAGCGAGGACCACCCCAAAG AGG Intronic
901195760 1:7439029-7439051 GAGGGAAGGCCACCACAAAGAGG + Intronic
902521960 1:17023744-17023766 CAGTGAGGGTCACCCCAAAGGGG - Intronic
904352649 1:29918936-29918958 GAGGGAGACCCACCCCCAAGGGG - Intergenic
907945582 1:59133426-59133448 GAATGAGCACCAACCCAAAGAGG - Intergenic
909718148 1:78735443-78735465 GACCAAAGACAACCCCAAAGAGG + Intergenic
918235291 1:182574458-182574480 GTGTGTGGACCACCCCACAGAGG - Exonic
922607012 1:226895770-226895792 AAGCGAGGCGCTCCCCAAAGCGG - Exonic
923537827 1:234866675-234866697 GAGCAAGTAACACCACAAAGAGG + Intergenic
1067851891 10:49759790-49759812 GTGCAAGGACCACCCCACAAGGG + Intronic
1070966239 10:80532972-80532994 GAGCAGGGACCCCCCCAGAGAGG - Exonic
1076536480 10:131181162-131181184 GAGCTGGGACCTCCCCACAGTGG + Intronic
1077106947 11:846291-846313 GACGGAGGTCCAACCCAAAGAGG - Intronic
1080689875 11:34547625-34547647 GAGCAAAGACCAGGCCAAAGGGG - Intergenic
1082087438 11:48061674-48061696 GTGCGAGTCCCACCCCAGAGGGG + Intronic
1082809633 11:57471611-57471633 GAGCCAGGCCTGCCCCAAAGGGG + Intronic
1083996902 11:66277341-66277363 GAGCGGGGGGCACCCCAAGGGGG - Exonic
1091281544 11:134384366-134384388 GAGCTAGGACCCTCCCAGAGAGG - Intronic
1096240343 12:49956441-49956463 GAGGGAGAACCTCTCCAAAGAGG + Exonic
1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG + Intronic
1103396581 12:120611827-120611849 ATGCGGGCACCACCCCAAAGTGG + Intergenic
1107505213 13:41026964-41026986 ATGCGAGCACCACCCAAAAGCGG + Intronic
1109214509 13:59572607-59572629 GAGTGAGGAAGATCCCAAAGGGG - Intergenic
1111354336 13:87079533-87079555 GAGCTAGGACCACAGCAGAGTGG - Intergenic
1114152166 14:20054559-20054581 GAGGCAGAACCACCCCCAAGAGG - Intergenic
1119413734 14:74455825-74455847 GAGGGAGGAACACCCAGAAGCGG - Intergenic
1122812209 14:104294657-104294679 GAGCGAGGCCCACCCGCATGGGG - Intergenic
1123473460 15:20571173-20571195 GAGCCAGGCCCTCCCCAGAGAGG - Intergenic
1123644549 15:22429180-22429202 GAGCCAGGCCCTCCCCAGAGAGG + Intergenic
1123733757 15:23166184-23166206 GAGCCAGGCCCTCCCCAGAGAGG - Intergenic
1124284254 15:28387483-28387505 GAGCCAGGCCCTCCCCAGAGAGG - Intronic
1124298443 15:28524131-28524153 GAGCCAGGCCCTCCCCAGAGAGG + Intronic
1125894075 15:43287394-43287416 GGGCGAGGACTACTCCAAAGGGG - Exonic
1132518599 16:377288-377310 GAGCGAGGACCACCCCAAAGAGG + Intronic
1133173034 16:3993437-3993459 GAGGGAGGAGCACCTCAAAACGG - Exonic
1140212701 16:72983385-72983407 GAATGAGGGCAACCCCAAAGGGG + Intronic
1140554815 16:75909768-75909790 GAGCTAGGCCCACCTCAAAAGGG - Intergenic
1141597754 16:85107715-85107737 GGGGGCGGACCACCCCAACGGGG - Intronic
1142060391 16:88025519-88025541 GAGGGAAGAACACCCTAAAGTGG - Intronic
1151251578 17:72839875-72839897 GAGTGAGAACCACGCCAACGTGG + Intronic
1152828940 17:82485623-82485645 AGGCGAGGACCTCCACAAAGTGG - Exonic
1155657894 18:28211972-28211994 GAGCAAGGGCCTGCCCAAAGAGG + Intergenic
1161802990 19:6426095-6426117 GAGCCAGGACGACCCACAAGGGG + Exonic
1162620162 19:11836590-11836612 GCCCAAGGAGCACCCCAAAGAGG + Intergenic
1162624283 19:11871775-11871797 GCCCAAGGAGCACCCCAAAGAGG + Intronic
1162629442 19:11915480-11915502 GCCCAAGGAGCACCCCAAAGAGG + Intergenic
1164182504 19:22832059-22832081 GAGCCAGGCCCACCTCAGAGGGG - Intergenic
1166761556 19:45227616-45227638 GAGGGAGGACCAATCCAAGGTGG - Intronic
1167455048 19:49593459-49593481 GGGGGAGGGCCAGCCCAAAGCGG - Intronic
1167622632 19:50567990-50568012 GGGGGAGGACCCCCCCAATGAGG + Intronic
931103186 2:59025390-59025412 GAGGGAAGTCCACCCAAAAGAGG - Intergenic
937145466 2:119640669-119640691 GAATGAGGCCCACCCCAAGGTGG + Intronic
940892633 2:159049620-159049642 TAGTGAGGACCTCCCCAGAGTGG + Intronic
947491080 2:230594594-230594616 TAGCTTGGACCACCCCTAAGGGG + Intergenic
948521487 2:238541496-238541518 GAAAGAGCACCACACCAAAGGGG - Intergenic
1169017274 20:2302163-2302185 CAGGGAGGACCACACCACAGAGG - Intronic
1175429549 20:58891750-58891772 GACCGAGGACCAGCGCAACGAGG + Intronic
1175741110 20:61420312-61420334 GAGCAAGGAGCACCCCTGAGTGG - Intronic
1176034286 20:63028835-63028857 GAGCGAGGCCCACCCTGCAGGGG + Intergenic
1176090341 20:63315783-63315805 GAGTGAGGCCCTCCCCAGAGAGG + Intronic
1185368915 22:50450101-50450123 GAGGGAGCACCACAGCAAAGGGG + Intronic
952751999 3:36832178-36832200 GGGCCAGCACCACCCCACAGTGG + Exonic
954438878 3:50510815-50510837 GTGCCAGCACCACCCCAAGGAGG - Intergenic
965730789 3:171770459-171770481 GAGGGAGGACAACCCCAACTGGG + Intronic
969299840 4:6291422-6291444 GAGCCAGGACCTTCCCATAGGGG + Intronic
992722495 5:79574571-79574593 GACAGAGGACCTCCCAAAAGGGG + Intergenic
1000417017 5:160994277-160994299 ATGCAAGCACCACCCCAAAGTGG + Intergenic
1002327777 5:178420804-178420826 GCATGAAGACCACCCCAAAGTGG - Intronic
1003166150 6:3680144-3680166 GAGCTAGAATCACTCCAAAGAGG - Intergenic
1003590484 6:7432796-7432818 TAGGGAGGGCCACACCAAAGGGG + Intergenic
1023913583 7:44572099-44572121 GAGCAAGGACCTCCCCTAAGGGG - Intronic
1033942598 7:146674650-146674672 AAGCAAGGAATACCCCAAAGAGG + Intronic
1034323264 7:150204862-150204884 GAGCGAGGAACATGCCAAGGAGG + Intergenic
1040110808 8:43566522-43566544 GAGTGGGGGGCACCCCAAAGCGG - Intergenic
1048474135 8:134727978-134728000 GAGACAGGAGCACCCAAAAGTGG - Intergenic
1049287042 8:141781504-141781526 GAGCAAGGAGCACCCGAGAGAGG + Intergenic
1052150955 9:25115111-25115133 GTGGGAGGACCAACCCAATGTGG - Intergenic
1061851470 9:133418361-133418383 GAGCAAGGAGCAGCCCAAGGCGG - Intronic
1190278467 X:48914137-48914159 TAGCAAGGACCAGGCCAAAGGGG + Exonic