ID: 1132519457

View in Genome Browser
Species Human (GRCh38)
Location 16:380818-380840
Sequence GGTGCTGTTCCCCGACTTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 1, 2: 0, 3: 9, 4: 139}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132519457_1132519472 26 Left 1132519457 16:380818-380840 CCGGGAAGTCGGGGAACAGCACC 0: 1
1: 1
2: 0
3: 9
4: 139
Right 1132519472 16:380867-380889 CCGCGTGGCTGGGGACGTGTGGG 0: 1
1: 0
2: 1
3: 8
4: 134
1132519457_1132519468 17 Left 1132519457 16:380818-380840 CCGGGAAGTCGGGGAACAGCACC 0: 1
1: 1
2: 0
3: 9
4: 139
Right 1132519468 16:380858-380880 CCTGGGCACCCGCGTGGCTGGGG 0: 1
1: 0
2: 2
3: 27
4: 274
1132519457_1132519466 16 Left 1132519457 16:380818-380840 CCGGGAAGTCGGGGAACAGCACC 0: 1
1: 1
2: 0
3: 9
4: 139
Right 1132519466 16:380857-380879 ACCTGGGCACCCGCGTGGCTGGG 0: 1
1: 0
2: 0
3: 11
4: 122
1132519457_1132519465 15 Left 1132519457 16:380818-380840 CCGGGAAGTCGGGGAACAGCACC 0: 1
1: 1
2: 0
3: 9
4: 139
Right 1132519465 16:380856-380878 CACCTGGGCACCCGCGTGGCTGG 0: 1
1: 0
2: 0
3: 18
4: 126
1132519457_1132519459 -8 Left 1132519457 16:380818-380840 CCGGGAAGTCGGGGAACAGCACC 0: 1
1: 1
2: 0
3: 9
4: 139
Right 1132519459 16:380833-380855 ACAGCACCGCATCAGCTGCCGGG 0: 1
1: 0
2: 0
3: 14
4: 119
1132519457_1132519462 0 Left 1132519457 16:380818-380840 CCGGGAAGTCGGGGAACAGCACC 0: 1
1: 1
2: 0
3: 9
4: 139
Right 1132519462 16:380841-380863 GCATCAGCTGCCGGGCACCTGGG 0: 1
1: 0
2: 1
3: 20
4: 179
1132519457_1132519470 25 Left 1132519457 16:380818-380840 CCGGGAAGTCGGGGAACAGCACC 0: 1
1: 1
2: 0
3: 9
4: 139
Right 1132519470 16:380866-380888 CCCGCGTGGCTGGGGACGTGTGG 0: 1
1: 0
2: 2
3: 10
4: 161
1132519457_1132519458 -9 Left 1132519457 16:380818-380840 CCGGGAAGTCGGGGAACAGCACC 0: 1
1: 1
2: 0
3: 9
4: 139
Right 1132519458 16:380832-380854 AACAGCACCGCATCAGCTGCCGG 0: 1
1: 0
2: 0
3: 7
4: 82
1132519457_1132519464 11 Left 1132519457 16:380818-380840 CCGGGAAGTCGGGGAACAGCACC 0: 1
1: 1
2: 0
3: 9
4: 139
Right 1132519464 16:380852-380874 CGGGCACCTGGGCACCCGCGTGG 0: 1
1: 0
2: 1
3: 7
4: 140
1132519457_1132519461 -1 Left 1132519457 16:380818-380840 CCGGGAAGTCGGGGAACAGCACC 0: 1
1: 1
2: 0
3: 9
4: 139
Right 1132519461 16:380840-380862 CGCATCAGCTGCCGGGCACCTGG 0: 1
1: 0
2: 1
3: 12
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132519457 Original CRISPR GGTGCTGTTCCCCGACTTCC CGG (reversed) Intronic