ID: 1132519457

View in Genome Browser
Species Human (GRCh38)
Location 16:380818-380840
Sequence GGTGCTGTTCCCCGACTTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 1, 2: 0, 3: 9, 4: 139}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132519457_1132519472 26 Left 1132519457 16:380818-380840 CCGGGAAGTCGGGGAACAGCACC 0: 1
1: 1
2: 0
3: 9
4: 139
Right 1132519472 16:380867-380889 CCGCGTGGCTGGGGACGTGTGGG 0: 1
1: 0
2: 1
3: 8
4: 134
1132519457_1132519465 15 Left 1132519457 16:380818-380840 CCGGGAAGTCGGGGAACAGCACC 0: 1
1: 1
2: 0
3: 9
4: 139
Right 1132519465 16:380856-380878 CACCTGGGCACCCGCGTGGCTGG 0: 1
1: 0
2: 0
3: 18
4: 126
1132519457_1132519459 -8 Left 1132519457 16:380818-380840 CCGGGAAGTCGGGGAACAGCACC 0: 1
1: 1
2: 0
3: 9
4: 139
Right 1132519459 16:380833-380855 ACAGCACCGCATCAGCTGCCGGG 0: 1
1: 0
2: 0
3: 14
4: 119
1132519457_1132519458 -9 Left 1132519457 16:380818-380840 CCGGGAAGTCGGGGAACAGCACC 0: 1
1: 1
2: 0
3: 9
4: 139
Right 1132519458 16:380832-380854 AACAGCACCGCATCAGCTGCCGG 0: 1
1: 0
2: 0
3: 7
4: 82
1132519457_1132519466 16 Left 1132519457 16:380818-380840 CCGGGAAGTCGGGGAACAGCACC 0: 1
1: 1
2: 0
3: 9
4: 139
Right 1132519466 16:380857-380879 ACCTGGGCACCCGCGTGGCTGGG 0: 1
1: 0
2: 0
3: 11
4: 122
1132519457_1132519462 0 Left 1132519457 16:380818-380840 CCGGGAAGTCGGGGAACAGCACC 0: 1
1: 1
2: 0
3: 9
4: 139
Right 1132519462 16:380841-380863 GCATCAGCTGCCGGGCACCTGGG 0: 1
1: 0
2: 1
3: 20
4: 179
1132519457_1132519468 17 Left 1132519457 16:380818-380840 CCGGGAAGTCGGGGAACAGCACC 0: 1
1: 1
2: 0
3: 9
4: 139
Right 1132519468 16:380858-380880 CCTGGGCACCCGCGTGGCTGGGG 0: 1
1: 0
2: 2
3: 27
4: 274
1132519457_1132519470 25 Left 1132519457 16:380818-380840 CCGGGAAGTCGGGGAACAGCACC 0: 1
1: 1
2: 0
3: 9
4: 139
Right 1132519470 16:380866-380888 CCCGCGTGGCTGGGGACGTGTGG 0: 1
1: 0
2: 2
3: 10
4: 161
1132519457_1132519464 11 Left 1132519457 16:380818-380840 CCGGGAAGTCGGGGAACAGCACC 0: 1
1: 1
2: 0
3: 9
4: 139
Right 1132519464 16:380852-380874 CGGGCACCTGGGCACCCGCGTGG 0: 1
1: 0
2: 1
3: 7
4: 140
1132519457_1132519461 -1 Left 1132519457 16:380818-380840 CCGGGAAGTCGGGGAACAGCACC 0: 1
1: 1
2: 0
3: 9
4: 139
Right 1132519461 16:380840-380862 CGCATCAGCTGCCGGGCACCTGG 0: 1
1: 0
2: 1
3: 12
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132519457 Original CRISPR GGTGCTGTTCCCCGACTTCC CGG (reversed) Intronic
900350712 1:2233241-2233263 GGTCCTGTTCCCAGAGGTCCGGG + Intronic
900718714 1:4161406-4161428 GGTGCTGTTGTCCGGGTTCCGGG + Intergenic
901023725 1:6268204-6268226 CGTTCTGTTCACCCACTTCCAGG - Intronic
904261824 1:29291865-29291887 GGTCATGTTCACCGGCTTCCTGG - Exonic
907213369 1:52842322-52842344 GGTGCTGTTGCCAGATTTTCAGG + Intergenic
907447467 1:54518030-54518052 GGTCCCGTCCCCCGACTGCCAGG - Intergenic
911608632 1:99936321-99936343 GGTGCTGCCCCCTGACTGCCTGG - Intergenic
914950299 1:152108167-152108189 GCTGCTGTTCCTCCCCTTCCTGG + Exonic
916739704 1:167637505-167637527 GCTGCTCTTCCCCCACCTCCTGG + Intronic
918860626 1:189821520-189821542 GGTGCAGTTCCACTACTTCTGGG - Intergenic
920779212 1:208971689-208971711 GCTGCTGTTGCCCCACTTACAGG + Intergenic
1064722693 10:18246019-18246041 GGAGCTGTTCTCCGGGTTCCAGG - Intronic
1066074699 10:31861561-31861583 TCTGCTCTTCCCCCACTTCCTGG - Exonic
1066140486 10:32500226-32500248 GGGGCTGCCCCCCGACCTCCTGG + Intronic
1068976415 10:63015258-63015280 GGTGCTTTTCCCACCCTTCCAGG - Intergenic
1069959785 10:72072910-72072932 GCTGCTGTTCCCTGATCTCCAGG - Exonic
1070145810 10:73772582-73772604 AGGGCTATTCCCCCACTTCCCGG + Exonic
1072321727 10:94256766-94256788 GGTGCTGATCCCTGTCCTCCTGG - Intronic
1073535102 10:104269214-104269236 GGTCCGGTTGCCCGAGTTCCCGG + Exonic
1074559419 10:114521860-114521882 GGCACTGTTCCCCGACTATCTGG - Intronic
1078107214 11:8365860-8365882 GGTGCTGAAGCCCGAGTTCCAGG - Intergenic
1079763889 11:24365522-24365544 GGAGCTGTTCCCAAACCTCCGGG + Intergenic
1084627228 11:70317809-70317831 AGTGCTCTTCCTCCACTTCCAGG + Intronic
1085274536 11:75289869-75289891 GGTGCTGCTCCCCGTCTTAGGGG - Intronic
1085661170 11:78368233-78368255 GTTGCTGTTCATGGACTTCCTGG - Intronic
1087710153 11:101539352-101539374 GCTGCTGTTCTCAGACTGCCTGG + Intronic
1090072874 11:123559759-123559781 GTAGCTGCTCCCAGACTTCCAGG - Intronic
1094716955 12:33022887-33022909 GGGGCTGACCCCCCACTTCCTGG + Intergenic
1117393512 14:55285398-55285420 CATGCTGTTCCTCGACTCCCAGG - Intronic
1119407171 14:74406135-74406157 GGTGCTGCCCCCCGCCTACCTGG + Exonic
1121312931 14:92944899-92944921 GTGGCTGCTCCCCGACTCCCAGG + Intronic
1122652104 14:103231693-103231715 CCTGCTGTCCCCCTACTTCCTGG - Intergenic
1123063828 14:105606388-105606410 CCTCCTGTTCCCCCACTTCCCGG + Intergenic
1123904356 15:24907202-24907224 GGTATTATTCCCTGACTTCCTGG - Intronic
1124483578 15:30097903-30097925 GGTGCTGGTACCTGTCTTCCCGG - Intergenic
1124490030 15:30149965-30149987 GGTGCTGGTACCTGTCTTCCTGG - Intergenic
1124520000 15:30399323-30399345 GGTGCTGGTACCTGTCTTCCCGG + Intergenic
1124538654 15:30566901-30566923 GGTGCTGGTACCTGTCTTCCCGG - Intergenic
1124753502 15:32388362-32388384 GGTGCTGGTACCTGTCTTCCTGG + Intergenic
1124759997 15:32440681-32440703 GGTGCTGGTACCTGTCTTCCGGG + Intergenic
1124882517 15:33655584-33655606 GGTGCTGGTACCCTACCTCCTGG + Intronic
1124975245 15:34524064-34524086 GGTGCTGGTACCTGTCTTCCCGG + Intergenic
1127772225 15:62241471-62241493 GGTGCTGGTACCTGCCTTCCCGG + Intergenic
1129239060 15:74241030-74241052 AGTGCTGTTCCCTGCCCTCCTGG - Intronic
1130282446 15:82530782-82530804 GGTGCTGGTATCTGACTTCCCGG - Intergenic
1130652449 15:85769766-85769788 CGTGCTGCTCCGCGACTTGCGGG + Exonic
1132185112 15:99797200-99797222 GGTGCTGGTGCCTGTCTTCCCGG - Intergenic
1132519457 16:380818-380840 GGTGCTGTTCCCCGACTTCCCGG - Intronic
1132783436 16:1641512-1641534 GGGGCTGGTCCCCGGCTTCTAGG + Intronic
1132958761 16:2610837-2610859 GGTGCTCTTCCTCTTCTTCCTGG - Intergenic
1133728882 16:8561112-8561134 GTTGCAGTTCCCAGAATTCCAGG - Intergenic
1134456324 16:14398163-14398185 AGTGCTGAGCCCCGGCTTCCTGG - Intergenic
1136573272 16:31109101-31109123 GGGGCTCTTCTCCGACTTCAGGG - Exonic
1139514377 16:67444750-67444772 GGTGCTATGCCAGGACTTCCCGG - Intronic
1139659591 16:68411637-68411659 GCTGCTGTTCCCCCACTGCTGGG - Intronic
1142780270 17:2176114-2176136 GGTGATGTTGCCCAGCTTCCAGG - Intronic
1144489969 17:15700113-15700135 GATGCTGTCCCCGGGCTTCCAGG + Exonic
1144910992 17:18681846-18681868 GATGCTGTCCCCGGGCTTCCAGG - Exonic
1148758209 17:49985704-49985726 GCTGCCCTTCCCTGACTTCCTGG + Intergenic
1149678141 17:58485423-58485445 GATGCTCTTCCCCCTCTTCCAGG - Intronic
1150172853 17:63018272-63018294 GGTCTTGAACCCCGACTTCCCGG - Intronic
1150373398 17:64661507-64661529 GGGGCTGTTCCCCGAGCCCCGGG + Intronic
1150778820 17:68102260-68102282 GGGGCTGTTCCCCGAGCCCCGGG - Intergenic
1151297134 17:73193618-73193640 GGCGCTTTCCCCCGACTTCCGGG + Intronic
1151500334 17:74484165-74484187 GGAGCTGTCCCTGGACTTCCTGG - Exonic
1151955780 17:77379515-77379537 GGTGCTGTTCCCTGATAGCCTGG + Intronic
1152466547 17:80469844-80469866 GGTGCTGGGGCCCGGCTTCCCGG + Exonic
1152699548 17:81812222-81812244 CCTGCGGTTCCCCGTCTTCCTGG + Exonic
1159045671 18:63366974-63366996 GTTGCTGCCCCCCGACTTACCGG - Intronic
1160083642 18:75754074-75754096 GGTGCTGTTGCCACTCTTCCAGG - Intergenic
1160535701 18:79590225-79590247 GGTTCTGCTCCCCCACTGCCCGG - Intergenic
1160754483 19:750568-750590 CGTGATGTTCCCCCACGTCCCGG + Intergenic
1162446988 19:10729495-10729517 GATGCTGTTCCCCCAAGTCCTGG - Intronic
1163105857 19:15122754-15122776 CGTGCTGTACCCCTACTTCATGG - Exonic
1163394285 19:17050094-17050116 GGGTCTCTTCCCAGACTTCCTGG + Exonic
1163724586 19:18915455-18915477 TGTGGTTTTCCTCGACTTCCAGG + Intronic
1165062667 19:33212453-33212475 GGTGCTGACCCCCGACTTCTGGG - Intronic
1166098115 19:40554317-40554339 GGTGCTGGACGCCGCCTTCCAGG + Exonic
1168349432 19:55667659-55667681 GATGCTGTTCTGAGACTTCCCGG + Intronic
926977911 2:18533449-18533471 GGTGGTGTTCCCTGATTGCCAGG - Intergenic
931922520 2:67036807-67036829 GGTTATGTTCTCCAACTTCCCGG - Intergenic
932716052 2:74101332-74101354 GGTGCTGTTCCCAAACTTGCAGG - Exonic
933787207 2:85852881-85852903 AGTGCTGCTCCCCGCTTTCCAGG - Intronic
935975354 2:108572941-108572963 GTTGCTGTTCCGCAGCTTCCTGG + Intronic
938795941 2:134718602-134718624 GGCGCGGAGCCCCGACTTCCCGG - Intronic
940354952 2:152730589-152730611 GGTTCTGTTCACCCAATTCCAGG + Intronic
943524648 2:189001542-189001564 GGTGGTGCCCCCGGACTTCCAGG + Exonic
1173250351 20:41361215-41361237 GGTGATGTTCCCCGAGTTGGTGG + Exonic
1174779519 20:53376052-53376074 GGTGGTCTTCCCTGACTCCCAGG - Intronic
1175133846 20:56808553-56808575 GGTGCTGTTTCCGGGTTTCCTGG + Intergenic
1175384208 20:58583858-58583880 GGTGATGTCCCCCACCTTCCTGG + Intergenic
1175424054 20:58853322-58853344 CGGGCTGTTCCCCGATTTCAGGG - Exonic
1178370193 21:32021031-32021053 GGTGCTCTGCCCAGACCTCCAGG + Intronic
1183381536 22:37492713-37492735 GGTGCTGTTGCCTGAGTGCCTGG - Exonic
1185208170 22:49552063-49552085 GGTGCTCTTCCCGGGCATCCCGG - Intronic
952336329 3:32406363-32406385 GGTGCAGGTCCTCTACTTCCAGG - Intronic
954375698 3:50193136-50193158 GGTGCTCTTCCCGGACTCACCGG - Exonic
954943232 3:54393907-54393929 TGTGCTGTTCCCTGCCTTCCAGG + Intronic
961830354 3:129619949-129619971 GGTGCTGCTCCCCTGCTGCCCGG - Intergenic
966314060 3:178625355-178625377 GCGGCTGCTCCCCGACTTCCAGG - Intronic
981750514 4:148089307-148089329 GGTGCTGTTTCCCAGCTTTCTGG - Intronic
985851328 5:2390971-2390993 GGCCCTGTTCCCCGCCTTCTGGG + Intergenic
992117529 5:73554964-73554986 GGTGCTGATCCCCAACTTTTAGG - Exonic
996330496 5:122323131-122323153 GGCGCTGTTGCCCGAGTTCATGG - Intronic
999060098 5:148624587-148624609 GGTGCTGTTTGCAGATTTCCTGG - Intronic
1000103429 5:158037217-158037239 GGGGCTGCCCCCCGACCTCCTGG + Intergenic
1002439580 5:179257385-179257407 GGTTCTGTTCCCCGGGCTCCCGG - Intronic
1003601279 6:7519773-7519795 GCTCCTTTTCCCCGGCTTCCTGG + Intergenic
1007171740 6:39868955-39868977 CTTGCTGTTCCCTGACTTTCTGG + Intronic
1007473367 6:42104695-42104717 GGTGCGGCTCCCCGACGTACAGG + Exonic
1011636762 6:89381908-89381930 GATGCTGTTTACAGACTTCCAGG - Intronic
1014546880 6:122745400-122745422 CCTGCTGTTCCCCCGCTTCCGGG - Intergenic
1015694017 6:135959233-135959255 GGTGCTATTCACCAACTTCATGG - Intronic
1019022347 6:168930008-168930030 GCTGCTGTTCCCCGGCTCTCGGG - Intergenic
1020011756 7:4809171-4809193 GGCGCTGTCCCCCGCCTCCCCGG + Intronic
1022853002 7:34284098-34284120 GGTGCTGTTGCCTCTCTTCCAGG - Intergenic
1022864141 7:34399791-34399813 GGAGCTGTTCCTGTACTTCCTGG + Intergenic
1033260812 7:139842642-139842664 GGTGCTGTTGCACAACTTCCTGG + Intronic
1034468337 7:151242816-151242838 GGAGCTGGTCCCCGAGTCCCAGG - Exonic
1035020977 7:155800301-155800323 GGTGCTGTCCCCAGCCCTCCTGG - Exonic
1035728246 8:1838086-1838108 TGTCCTGTTCCCCGAGGTCCTGG + Intronic
1036824187 8:11963670-11963692 GGTGCAGTTCCTCGGCTCCCTGG + Intergenic
1037766963 8:21778045-21778067 GGGGCTGTGCTCCGCCTTCCTGG - Intronic
1039913091 8:41840194-41840216 CGTGCTGGTCCCCCACTCCCGGG + Intronic
1041201062 8:55452314-55452336 GGTGGTGTTCCGCTCCTTCCCGG - Intronic
1041875469 8:62682584-62682606 GGTGCTGCTCGCCCACTGCCTGG + Intronic
1044277232 8:90316003-90316025 GGTCCTGTTTCCCTACTTCCTGG + Intergenic
1045375193 8:101565660-101565682 GGTGCAGTTGCGCCACTTCCAGG - Intronic
1047473664 8:125204303-125204325 GGAGGTGTTCCCAGACTTCCTGG + Intronic
1049759894 8:144327155-144327177 TGCGCTGGGCCCCGACTTCCTGG + Intergenic
1052969868 9:34370840-34370862 GGTGCTGCTCACCGATTACCCGG - Exonic
1054963758 9:70998754-70998776 GGTGCTGTAATCCGAGTTCCAGG - Intronic
1055073942 9:72194631-72194653 GGTTGTGTTCCCCCCCTTCCCGG + Intronic
1055690210 9:78821957-78821979 GCTGTTTTGCCCCGACTTCCTGG - Intergenic
1056521424 9:87405245-87405267 GGTGCTCTTCCCCAGCTCCCAGG + Intergenic
1056696298 9:88856839-88856861 GGTGCTCTTCCCCTTCTTCTAGG - Intergenic
1057436446 9:95045057-95045079 GGTGCTGTTTCCTGACACCCTGG + Intronic
1059246527 9:112854361-112854383 GCTGCTGTTGTCCGCCTTCCTGG + Intronic
1060794270 9:126503876-126503898 GGTGCTGCTCCCCGACTTCCAGG - Exonic
1060934656 9:127508081-127508103 GGGGCTGCTCACCGACTTGCAGG + Exonic
1061188284 9:129067883-129067905 TGTGCTGAACCCCGACATCCCGG + Intronic
1061514838 9:131082959-131082981 GCTCCTGTTCCCCAGCTTCCTGG + Intronic
1062355159 9:136158408-136158430 GGTGCTGGGCCCAGGCTTCCAGG + Intergenic
1062626676 9:137446129-137446151 CGTGCTGTTCCCAGCCTGCCAGG + Intergenic
1190325140 X:49202248-49202270 GGTGCTGGAGCCAGACTTCCTGG - Intergenic
1191111342 X:56805110-56805132 GGTACTGTTGCCCTTCTTCCTGG - Intergenic
1198429698 X:136553237-136553259 GATCCTGCTCCCCCACTTCCTGG + Intronic
1199727263 X:150596531-150596553 GAGGCTGTTCCTCGACTTCCAGG + Exonic
1200151495 X:153953567-153953589 CGTGTTCTTCCCCGCCTTCCCGG - Intronic
1202604404 Y:26626700-26626722 GGGGCTGTGCCTCCACTTCCAGG - Intergenic