ID: 1132519461 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:380840-380862 |
| Sequence | CGCATCAGCTGCCGGGCACC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 129 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 12, 4: 115} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1132519457_1132519461 | -1 | Left | 1132519457 | 16:380818-380840 | CCGGGAAGTCGGGGAACAGCACC | 0: 1 1: 1 2: 0 3: 9 4: 139 |
||
| Right | 1132519461 | 16:380840-380862 | CGCATCAGCTGCCGGGCACCTGG | 0: 1 1: 0 2: 1 3: 12 4: 115 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1132519461 | Original CRISPR | CGCATCAGCTGCCGGGCACC TGG | Intronic | ||