ID: 1132519462 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:380841-380863 |
| Sequence | GCATCAGCTGCCGGGCACCT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 201 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 20, 4: 179} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1132519457_1132519462 | 0 | Left | 1132519457 | 16:380818-380840 | CCGGGAAGTCGGGGAACAGCACC | 0: 1 1: 1 2: 0 3: 9 4: 139 |
||
| Right | 1132519462 | 16:380841-380863 | GCATCAGCTGCCGGGCACCTGGG | 0: 1 1: 0 2: 1 3: 20 4: 179 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1132519462 | Original CRISPR | GCATCAGCTGCCGGGCACCT GGG | Intronic | ||