ID: 1132520001

View in Genome Browser
Species Human (GRCh38)
Location 16:382430-382452
Sequence CAGCACGGGGACCCCCGGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 568
Summary {0: 1, 1: 0, 2: 5, 3: 75, 4: 487}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132519985_1132520001 17 Left 1132519985 16:382390-382412 CCTGCCCCGCCCGGCGCGCGTGG 0: 1
1: 0
2: 2
3: 44
4: 405
Right 1132520001 16:382430-382452 CAGCACGGGGACCCCCGGGCCGG 0: 1
1: 0
2: 5
3: 75
4: 487
1132519982_1132520001 23 Left 1132519982 16:382384-382406 CCCTGCCCTGCCCCGCCCGGCGC 0: 1
1: 2
2: 23
3: 449
4: 1791
Right 1132520001 16:382430-382452 CAGCACGGGGACCCCCGGGCCGG 0: 1
1: 0
2: 5
3: 75
4: 487
1132519990_1132520001 11 Left 1132519990 16:382396-382418 CCGCCCGGCGCGCGTGGGCCTGA 0: 1
1: 0
2: 2
3: 3
4: 56
Right 1132520001 16:382430-382452 CAGCACGGGGACCCCCGGGCCGG 0: 1
1: 0
2: 5
3: 75
4: 487
1132519979_1132520001 29 Left 1132519979 16:382378-382400 CCCGCGCCCTGCCCTGCCCCGCC 0: 1
1: 0
2: 41
3: 339
4: 1897
Right 1132520001 16:382430-382452 CAGCACGGGGACCCCCGGGCCGG 0: 1
1: 0
2: 5
3: 75
4: 487
1132519991_1132520001 8 Left 1132519991 16:382399-382421 CCCGGCGCGCGTGGGCCTGAGTC 0: 1
1: 0
2: 0
3: 5
4: 96
Right 1132520001 16:382430-382452 CAGCACGGGGACCCCCGGGCCGG 0: 1
1: 0
2: 5
3: 75
4: 487
1132519984_1132520001 18 Left 1132519984 16:382389-382411 CCCTGCCCCGCCCGGCGCGCGTG 0: 1
1: 0
2: 4
3: 25
4: 202
Right 1132520001 16:382430-382452 CAGCACGGGGACCCCCGGGCCGG 0: 1
1: 0
2: 5
3: 75
4: 487
1132519980_1132520001 28 Left 1132519980 16:382379-382401 CCGCGCCCTGCCCTGCCCCGCCC 0: 2
1: 29
2: 517
3: 1158
4: 4522
Right 1132520001 16:382430-382452 CAGCACGGGGACCCCCGGGCCGG 0: 1
1: 0
2: 5
3: 75
4: 487
1132519988_1132520001 13 Left 1132519988 16:382394-382416 CCCCGCCCGGCGCGCGTGGGCCT 0: 1
1: 0
2: 1
3: 16
4: 149
Right 1132520001 16:382430-382452 CAGCACGGGGACCCCCGGGCCGG 0: 1
1: 0
2: 5
3: 75
4: 487
1132519989_1132520001 12 Left 1132519989 16:382395-382417 CCCGCCCGGCGCGCGTGGGCCTG 0: 1
1: 1
2: 0
3: 18
4: 158
Right 1132520001 16:382430-382452 CAGCACGGGGACCCCCGGGCCGG 0: 1
1: 0
2: 5
3: 75
4: 487
1132519992_1132520001 7 Left 1132519992 16:382400-382422 CCGGCGCGCGTGGGCCTGAGTCA 0: 1
1: 0
2: 0
3: 5
4: 57
Right 1132520001 16:382430-382452 CAGCACGGGGACCCCCGGGCCGG 0: 1
1: 0
2: 5
3: 75
4: 487
1132519994_1132520001 -7 Left 1132519994 16:382414-382436 CCTGAGTCAGGCGCCTCAGCACG 0: 1
1: 0
2: 1
3: 2
4: 64
Right 1132520001 16:382430-382452 CAGCACGGGGACCCCCGGGCCGG 0: 1
1: 0
2: 5
3: 75
4: 487
1132519983_1132520001 22 Left 1132519983 16:382385-382407 CCTGCCCTGCCCCGCCCGGCGCG 0: 1
1: 4
2: 33
3: 288
4: 1658
Right 1132520001 16:382430-382452 CAGCACGGGGACCCCCGGGCCGG 0: 1
1: 0
2: 5
3: 75
4: 487

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132520001 Original CRISPR CAGCACGGGGACCCCCGGGC CGG Intronic
900347398 1:2216272-2216294 CAGCACACGGCCCCCCAGGCTGG + Intergenic
900558090 1:3290004-3290026 CAGCAGGGGCAGCCCCAGGCAGG - Intronic
900840226 1:5042705-5042727 CCACACGGGGACCACCAGGCTGG - Intergenic
900889421 1:5438697-5438719 CAGCACAGGGACCCTGGGCCGGG + Intergenic
900994034 1:6110610-6110632 CAGAATGCCGACCCCCGGGCTGG - Intronic
901063782 1:6485535-6485557 GAGCGCGGGGACCCCGGGGAGGG + Intronic
901110049 1:6786186-6786208 CAGGACGGGGTCCCCCTGGCGGG - Intronic
901470927 1:9455996-9456018 CAGCAGGGGGACACCCAGGCTGG - Intergenic
901772115 1:11535739-11535761 CAGCACCAGGACCCCCATGCAGG + Intronic
902271207 1:15306562-15306584 CAGCATGGGGACCCCGGGCCTGG - Intronic
902406082 1:16184403-16184425 CAGCTCTGGGACTCCTGGGCAGG + Intergenic
903222763 1:21878200-21878222 CAGCATGGGGACCTCCGGGGAGG - Exonic
903703014 1:25264536-25264558 CAGCATGAGGACCCCGGGCCTGG + Intronic
903712282 1:25334862-25334884 CAGCATGAGGACCCCGGGCCTGG + Intronic
904566973 1:31434088-31434110 CAGCACGTGGACCGCCGTGTGGG + Exonic
905569250 1:38991141-38991163 CAGCAGGGGGCGCCCCGGGCCGG + Intergenic
905688748 1:39927381-39927403 CAGCCAGGCGACCCCAGGGCAGG - Intergenic
905912174 1:41662474-41662496 GAGCACGGGGACCCCGCCGCCGG + Intronic
906322540 1:44826225-44826247 GAGCACGGGCACCCCGGGGAGGG - Intronic
907021064 1:51067139-51067161 CAGCTCGGGGACCCTGGGCCTGG + Intergenic
907442876 1:54489426-54489448 CAGCGCGGGAGCCCCCGGGCTGG + Intergenic
907890905 1:58635746-58635768 CAGCAGGGGGACCCTGGGCCCGG - Intergenic
908911223 1:69073688-69073710 CAGCATGGGGACCCTGGGCCTGG + Intergenic
909241718 1:73221930-73221952 CAGCATGGGGACCCTGGGCCTGG + Intergenic
909274377 1:73666064-73666086 CAGCACAGGGACCCCGGGCCTGG - Intergenic
909632971 1:77786234-77786256 CAGCACGGGGACACTGGGCCTGG + Intronic
910409431 1:86924736-86924758 TAGCACGGGGACCCTGGGCCTGG + Intronic
910623701 1:89284316-89284338 CAGCATGGGGACCCTGGGCCTGG - Intergenic
910628869 1:89336974-89336996 CAGCACTGGGACCCTGGGCCTGG - Intergenic
911358464 1:96849025-96849047 CAGCATGGGGACCCTGGGCCCGG - Intergenic
911534961 1:99089248-99089270 CAGCACAAGGACCCTGGGGCTGG - Intergenic
911541570 1:99163911-99163933 CAGCATGGGGACCCTGGGCCCGG - Intergenic
911880803 1:103236363-103236385 CAGCACAGGGACCCTAGGCCTGG - Intergenic
911904357 1:103548078-103548100 CAGCACAGGGACCCTGGGCCCGG + Intronic
912263610 1:108132553-108132575 CAGCATGGGGACCCTGGGCCTGG + Intergenic
912279487 1:108297962-108297984 CAGCATGGGGACCCTGGGCCTGG + Intergenic
912288739 1:108396395-108396417 CAGCATGGGGACCCTGGGCCTGG - Intronic
912907119 1:113718792-113718814 CAGCATGGGGACCCTGGGTCCGG + Intronic
913278092 1:117158515-117158537 CAGCATGGGGACCCTGGGCCCGG + Intronic
915213372 1:154325659-154325681 CAGTACGGGGCCGCCGGGGCGGG + Intronic
915255781 1:154627645-154627667 CAGGAGGCGGACGCCCGGGCCGG - Intronic
915804375 1:158829044-158829066 CAGCACAGGGACCCTGGGCCTGG + Intergenic
916318731 1:163479506-163479528 CAGCACAGGGACCCTTGGCCTGG - Intergenic
916618819 1:166473265-166473287 CAGCATGGGGACCCTGGGCCAGG + Intergenic
916734835 1:167598378-167598400 CAGCACGGGGACCCTGGGCTTGG + Intergenic
917290812 1:173470826-173470848 CAGCATGGGGACCCTGGGCCTGG - Intergenic
918049229 1:180959767-180959789 CAGCACGGGGACCCCAGGCCTGG + Intergenic
918097098 1:181344770-181344792 TAGCACTGAGGCCCCCGGGCTGG + Intergenic
918787031 1:188776009-188776031 CAGCATGGGGACCCTGGGACTGG - Intergenic
919221783 1:194639423-194639445 CAGCACGGGGACCCCAGACTTGG - Intergenic
920114046 1:203607339-203607361 CAGCACAAGGACACCGGGGCGGG + Intergenic
920495352 1:206450863-206450885 CAGCACTGGGAGGCCCAGGCGGG + Intronic
921715986 1:218417712-218417734 CAGCACAGGGACCCTGGGCCAGG - Intronic
921945298 1:220882074-220882096 CCTTACGGGGACCCCCAGGCTGG + Intronic
922796698 1:228343074-228343096 CAGCACGGTGGCTCCCAGGCTGG - Intronic
923198030 1:231686543-231686565 CAGCATGGGGACCCTGGGCCCGG + Intronic
1062886162 10:1017977-1017999 GAGCACACGGACCCCTGGGCAGG - Exonic
1062947965 10:1475130-1475152 CAGCAGGAGGACCCCCGGGGAGG + Intronic
1063511357 10:6647847-6647869 CAGCGCGGGGCCCGGCGGGCTGG + Intergenic
1063626261 10:7692537-7692559 CAGCATGGGGACCCTGGGCCTGG + Intergenic
1064048727 10:12042534-12042556 CAACGCGGGAGCCCCCGGGCCGG - Intronic
1065347780 10:24765165-24765187 CAGCATGGGGACCCTGGGCCTGG + Intergenic
1065967418 10:30781192-30781214 CAGCACTGGGATGCCAGGGCAGG - Intergenic
1067545204 10:47187907-47187929 CAGCAAGGGGACCCCCTGTGTGG + Intergenic
1067666129 10:48280660-48280682 CAGCACGGGGACCCTGGGCCTGG + Intergenic
1067911415 10:50350559-50350581 CAGCACGGGGACCCTGGACCCGG - Intronic
1068354854 10:55897608-55897630 CAGCATGGGGACCCCGGACCTGG + Intergenic
1068676866 10:59777822-59777844 CAGCACGGGGACCCTAGGCCTGG + Intergenic
1068908380 10:62351985-62352007 CAGCATGGGGACCCTGGGCCTGG + Intergenic
1069069981 10:63983182-63983204 CAGCACGAGGACCCTGGGCCCGG - Intergenic
1069239684 10:66123875-66123897 CAGCACAGGGACCCTGGGCCTGG + Intronic
1069804108 10:71107184-71107206 CAGCATGGGGACCCTGGGCCTGG - Intergenic
1069913267 10:71772506-71772528 CAACACAGGGGCTCCCGGGCTGG - Intronic
1071018983 10:81029796-81029818 CAGCATGGGGACCCTGGGCCTGG + Intergenic
1073511063 10:104042636-104042658 AGGCACCGGGACCCCGGGGCAGG + Intronic
1073863167 10:107770583-107770605 CAGCCCTGGGAGCCCAGGGCAGG + Intergenic
1073993972 10:109294893-109294915 CAGCACAGGGACCCTGGGCCTGG - Intergenic
1074591868 10:114821707-114821729 CAGCCCGGGGAGGCCCGGCCAGG - Intergenic
1075207196 10:120457638-120457660 CAGCCCTGGATCCCCCGGGCAGG - Intronic
1075543708 10:123337488-123337510 CAGCAGGGGGACCCTGGGCCTGG + Intergenic
1076905198 10:133357842-133357864 TTGCACGGGGACCCCCGGGCCGG - Intronic
1078517987 11:12040835-12040857 CAGCACAGGGACCCTGGGTCCGG + Intergenic
1079657869 11:23004126-23004148 CAGCACGGGGACCCGGGGCCTGG + Intergenic
1079673676 11:23199176-23199198 CAGCATGGGGACCCTGGGCCTGG + Intergenic
1079798913 11:24844678-24844700 CAGCACAGGGACCCTGGGCCTGG - Intronic
1081108320 11:39100392-39100414 CAGCATGGGGACCCCAGACCTGG + Intergenic
1081568715 11:44276394-44276416 CAGCACGCTGACCCCGGGCCTGG + Intronic
1081992295 11:47344352-47344374 CAGCATGGGGACCACCGCACTGG - Intronic
1082766219 11:57169895-57169917 CAGCACAGGGACCCTGGGCCCGG + Intergenic
1083677289 11:64333194-64333216 CAGCATGGGGACCCCGGAGGTGG - Intergenic
1084129145 11:67119635-67119657 CGGCGCGGGGAGCCTCGGGCCGG + Intronic
1084418973 11:69050774-69050796 CAGCACAGGGCCCGGCGGGCTGG + Intronic
1084627481 11:70319534-70319556 AAGCACTGCTACCCCCGGGCTGG - Intronic
1084880692 11:72169561-72169583 CAGCACGGGGACCCTGGACCTGG - Intergenic
1085554985 11:77411740-77411762 CAGCTAGGGGAGCCCCAGGCAGG + Intronic
1085941861 11:81214294-81214316 CAGCACAGGGACCCTGGGCCTGG + Intergenic
1086231689 11:84577904-84577926 CAGCACAGGGACCCTGGGCCTGG - Intronic
1086580390 11:88392036-88392058 CAGCACAGGGACCCTGGGCCTGG + Intergenic
1086604968 11:88685634-88685656 CAGCACTGGGACCCTGGGCCAGG - Intronic
1086848712 11:91783332-91783354 CAGCACAGGGACCCTAGGCCTGG + Intergenic
1086933857 11:92722891-92722913 CAGCATGGGGACCCTGGGCCTGG + Intronic
1087497306 11:98907875-98907897 CAGCACAGGGACCCTGGGCCTGG - Intergenic
1087541870 11:99531609-99531631 CAGCACGGGGACGCTGGGCCTGG - Intronic
1087725110 11:101707711-101707733 CAGCACTGGGACCCTGGGCCGGG - Intronic
1088694580 11:112355859-112355881 CAGCAGGGGGCCCTCTGGGCAGG + Intergenic
1089284834 11:117398778-117398800 CAGCATGGGGACCCTGGGCCTGG + Intronic
1089564693 11:119364381-119364403 CAGCCCGCTGACCCCCGGCCAGG + Intronic
1091244588 11:134081397-134081419 CAGCACAGGGACCCTGGGCCCGG - Intronic
1091274739 11:134342564-134342586 CAGCACGGGGCCCCGCGGCAGGG - Intronic
1091651228 12:2311597-2311619 CATCACGGGGAACCAAGGGCAGG + Intronic
1092184344 12:6467750-6467772 CAGCATGGGGACCCTGGGCCTGG - Intronic
1093141879 12:15518330-15518352 CAGCACAGGGACCCTGGGCCTGG + Intronic
1093207030 12:16263674-16263696 CAGCACAGGGACCCTAGGCCTGG - Intronic
1095234980 12:39785223-39785245 CAGCATGGGGACCCCAGGCCTGG - Intronic
1096214367 12:49791419-49791441 CAGCACGGGGGCCTCCAGGAGGG + Exonic
1096853407 12:54458616-54458638 CAGCACGGGGAGACCAAGGCGGG - Intronic
1097146536 12:56943304-56943326 CAGCACGGGGACCCTGGGCCTGG - Intergenic
1097400743 12:59124961-59124983 CAACACGGGGACCCTGGGCCTGG + Intergenic
1097570561 12:61326292-61326314 CAGCACAGGGACCCTGGGCCCGG + Intergenic
1097999067 12:65921802-65921824 CAGCATGGGGACCCTGGGCCTGG - Intronic
1099008242 12:77260454-77260476 CAGCATGGGGACCCTGGGCCTGG + Intergenic
1099722523 12:86382659-86382681 CAGCACGGGGACCCTGGGCCCGG - Intronic
1099746221 12:86708142-86708164 CAGCATGGGGACCCTGGGCCTGG - Intronic
1102587554 12:113933650-113933672 AAGCAGGGGGACCCGCGGGCAGG + Intronic
1102758728 12:115366862-115366884 CAGCATGGGGACCCTAGGCCTGG - Intergenic
1103623772 12:122204101-122204123 CTCTGCGGGGACCCCCGGGCCGG - Intronic
1103702549 12:122855375-122855397 CAGCACAGGGCCCCCCGCGGGGG + Exonic
1104007751 12:124905991-124906013 TAGCACGGGGGCCCTGGGGCTGG - Intergenic
1104240568 12:126985008-126985030 CAGCATGGGGACCCTGGGCCCGG + Intergenic
1104568246 12:129903802-129903824 CGGCTCGGAGCCCCCCGGGCGGG + Intergenic
1104920401 12:132287640-132287662 CAGGACGGGGACCCCGGGGTGGG + Intronic
1105303501 13:19154366-19154388 GAGCACTGGGCCCCCTGGGCTGG - Intergenic
1105512205 13:21060850-21060872 CAGCCTCGGGACCCCCGGTCCGG - Intronic
1108419440 13:50233747-50233769 CAGCATGGGGACCCTGGGCCTGG - Intronic
1108724350 13:53163803-53163825 CAGCATGGGGACCCTGGGCCTGG + Intergenic
1108790648 13:53966145-53966167 CAGCATGGGGACCCTAGGCCCGG - Intergenic
1108936824 13:55891656-55891678 CAGCACAGGGACCCTGGGCCTGG + Intergenic
1109614130 13:64808676-64808698 CAGCACAGGGACCCTTGGCCTGG - Intergenic
1110543100 13:76727844-76727866 CAGCATGGGGACCCTGGGCCTGG - Intergenic
1112091907 13:96091142-96091164 GAGCCCGGAGACCCCCGGGAGGG + Exonic
1112308306 13:98295312-98295334 CAGCAGAGGGAGCCCTGGGCAGG + Intronic
1113280491 13:108782684-108782706 CAGCACGGGGACCCTGTGCCTGG - Intronic
1113743653 13:112727816-112727838 CAGCTCGGGGACTCCGGCGCTGG + Intronic
1113805853 13:113109770-113109792 CAGCACGGCCGCCCCGGGGCGGG + Intronic
1113895134 13:113759356-113759378 GAGCGTGGGGACCCCGGGGCTGG + Intronic
1114871656 14:26666023-26666045 CAGCATGGGGACCCTGGGCCTGG + Intergenic
1115021244 14:28684026-28684048 CTGCACGGGGACCCTTGGCCTGG - Intergenic
1115115863 14:29880221-29880243 CAGCAAGGGGACCCTGGGCCTGG - Intronic
1115404124 14:32996514-32996536 CAGCACAGGGACCCGGGGCCCGG - Intronic
1115752449 14:36505944-36505966 GAGCCCGGGGACCCCGGCGCAGG - Intronic
1115840326 14:37462330-37462352 CAGCACGGGGACCCTGGGGCTGG + Intronic
1115942186 14:38622083-38622105 CAGCATGGGGACCCTGGGCCTGG - Intergenic
1115968247 14:38916010-38916032 CAGCACAGGGACCATGGGGCTGG + Intergenic
1116120490 14:40717284-40717306 CAGCATGGGGACCCTAGGGCAGG - Intergenic
1116195191 14:41716132-41716154 CAGCACGGGGACCCTGGGACTGG + Intronic
1116854152 14:49937353-49937375 CAGCATGGGGACCCTGGGGCTGG - Intergenic
1118598352 14:67453405-67453427 CAGGACAGGGAGCCCCAGGCAGG - Intronic
1119616533 14:76102441-76102463 GAGCAGAGGTACCCCCGGGCTGG + Intergenic
1120091168 14:80334491-80334513 CAGCATGGGGACCCTGGGCCTGG + Intronic
1120166619 14:81208187-81208209 CAGCATGGGGACCCTGGGCCTGG - Intronic
1120393987 14:83944485-83944507 CAGCACAGGGACCCTGGGCCTGG + Intergenic
1120454633 14:84716351-84716373 CAGCACAGGGACCCTGGGTCTGG - Intergenic
1120956707 14:90089723-90089745 CAGCACGGGGACCCTGGGCCTGG - Intronic
1121343067 14:93116265-93116287 CAGGATGGGGCCCCCCGGGGGGG + Intronic
1122353158 14:101109093-101109115 GAGCACGGGGCCCCCTGGCCTGG + Intergenic
1122689177 14:103523378-103523400 CACCGCGGGTGCCCCCGGGCTGG - Intergenic
1122691409 14:103533622-103533644 CAGCAGGGGGGCCCCAGGGGAGG - Intronic
1123138217 14:106050299-106050321 CAGCACGGGCACCCTGGGCCTGG - Intergenic
1123934369 15:25187043-25187065 CAGCACTGGGACCCCTGGGCAGG - Intergenic
1124578524 15:30930553-30930575 GAGCACAGGGCCCCCCAGGCAGG - Exonic
1126109158 15:45165738-45165760 CAGGAAGGGCACCCCTGGGCCGG - Intergenic
1126873270 15:53011561-53011583 CAGCACGGGGAACCTGGGCCTGG + Intergenic
1128160938 15:65422630-65422652 CAGCTCGCAGACCCCCGCGCAGG + Intronic
1129521898 15:76191513-76191535 CAGGATGGGGTCCCCCAGGCTGG + Intronic
1129620145 15:77136932-77136954 CAGCAAGGGGACCCTGGGCCTGG - Intronic
1131556459 15:93404116-93404138 CAGCACGGGGACCCTGGGCCCGG - Intergenic
1131767955 15:95700849-95700871 CAGCACAGGGACCCTTGGCCTGG + Intergenic
1131829616 15:96345734-96345756 GACCTCGGGGACCTCCGGGCAGG + Intergenic
1132194134 15:99897418-99897440 CAGCACAGGGACCCTGGGCCTGG + Intergenic
1132520001 16:382430-382452 CAGCACGGGGACCCCCGGGCCGG + Intronic
1132576842 16:668244-668266 CAGCTCCGAGACCCCCGGGCCGG - Intronic
1132656683 16:1044459-1044481 CAGCACAGGGACACCCGCCCGGG + Intergenic
1133284198 16:4683034-4683056 AAGCACGGGGGCGCCCAGGCGGG - Intronic
1134441545 16:14302156-14302178 CAGCGCGGCCAACCCCGGGCCGG + Intergenic
1136910482 16:34141060-34141082 CATCCCGGGGATCCCAGGGCCGG - Intergenic
1136997947 16:35203579-35203601 TTGCATGGGGACCCCTGGGCAGG + Intergenic
1137028821 16:35503233-35503255 CTGCATGGTGACCCCTGGGCAGG + Intergenic
1137266315 16:46871719-46871741 CAGCACGGGGACCCTGGGCCTGG + Intergenic
1138593028 16:58012979-58013001 CAGCACCTGGACCCCTGGGCTGG + Intronic
1139390639 16:66604864-66604886 GAGCCCGGGGACCGCGGGGCCGG - Exonic
1142195607 16:88737991-88738013 CAGCAGGAGGACGCCGGGGCTGG + Exonic
1142752879 17:1998762-1998784 GCGCACGGGGACCCCGGGGTGGG + Intronic
1143136585 17:4715875-4715897 CAGCCTGGAGATCCCCGGGCAGG + Intronic
1143642472 17:8206976-8206998 CAGGCCGGGGACACCAGGGCTGG + Intronic
1146190043 17:30756946-30756968 CAGCACTGGGAGGCCAGGGCGGG + Intergenic
1149051443 17:52310017-52310039 CAGCACGAGGACCCTGGGCCTGG + Intergenic
1149064635 17:52465576-52465598 CAGCAGGGGGACCCTGGGCCTGG - Intergenic
1149216235 17:54357709-54357731 CAACATGGGGACCCCAGGCCTGG + Intergenic
1149308631 17:55373101-55373123 CAGCACTGGGACCCTGGGCCTGG - Intergenic
1151051571 17:70984417-70984439 CAGCATGGGGACCCTGGGCCTGG + Intergenic
1152214491 17:79024503-79024525 CAGCGCTGGGTCCCCCGGCCCGG - Intronic
1152529105 17:80906550-80906572 AAGCACAGGGACCGCCGGCCAGG + Intronic
1152989374 18:349189-349211 CAGCATGGGGACCCTGGGCCTGG - Intronic
1153226801 18:2906325-2906347 CAGCCCTGGGGCCCCCCGGCAGG + Intronic
1154049730 18:10942843-10942865 CAGCACGGGGACCCTGAGCCTGG - Intronic
1155053239 18:22165748-22165770 CCGCCCGGGGACCCCGGCGCTGG + Intergenic
1155675610 18:28425611-28425633 CAGCACGGGGACCCTGGGTCTGG - Intergenic
1155818679 18:30347869-30347891 CAGCATGGGGACCCTGGGCCTGG + Intergenic
1156081387 18:33340586-33340608 CAGCATGGGGACCCTGGGCCTGG - Intronic
1157408790 18:47446526-47446548 CAGCACAGGGACCCAGGGCCTGG - Intergenic
1158905335 18:62005997-62006019 CAGCACGTGGACCCAGGGCCTGG + Intergenic
1160096421 18:75877719-75877741 CAGCACAGGGACCCTAGGTCTGG - Intergenic
1160677132 19:397429-397451 CAGGATGGGGCCCCCGGGGCAGG - Intergenic
1160765180 19:804465-804487 CAGCCCGGGGACCTCGGGGGTGG + Intronic
1160847121 19:1171541-1171563 CAGCATGGGGGCCCCCTGGGAGG + Intronic
1160867209 19:1261214-1261236 CCGCACGTGGACCCCCGGCACGG + Intronic
1160893038 19:1389444-1389466 CAGCACAGGGGCCTCCGGGAGGG - Intronic
1161107502 19:2451913-2451935 CAGCCAGGGGACACCGGGGCAGG + Intronic
1161330307 19:3683763-3683785 CAGTACGGAGGCCCCGGGGCAGG + Intronic
1161566785 19:5006944-5006966 CAGCAAGGGGACACCAGAGCGGG + Intronic
1162596468 19:11633439-11633461 CAGCACGGGGACCCTGGGCCTGG - Intergenic
1162742816 19:12783066-12783088 CGGCCAGGGGACCCCCGGGCTGG - Intronic
1163103282 19:15109897-15109919 CAGCGTGGGGGGCCCCGGGCCGG + Exonic
1164701721 19:30289492-30289514 AAGCACGGGGGCCCCCGGGGTGG - Intronic
1164996100 19:32720837-32720859 CACCAGGGGGCACCCCGGGCTGG + Intronic
1165058609 19:33194391-33194413 CGGCCCGGGGACGCCGGGGCCGG + Intronic
1165092497 19:33394394-33394416 CGCCAAGGGGACCCCCGGGCCGG - Intronic
1166543318 19:43619744-43619766 AAGCACGGCGCCCCCCGCGCGGG - Exonic
1167413733 19:49360056-49360078 CAGATGGGGGAACCCCGGGCTGG - Exonic
1167797201 19:51717114-51717136 CTGGACGAGGACCCCCGGGTAGG - Exonic
925275201 2:2643699-2643721 CAGCCCAGGGGCCCACGGGCTGG - Intergenic
926938899 2:18114951-18114973 CAGCAGGGGGACCCTGGGCCTGG - Intronic
927210261 2:20634859-20634881 CAGCACGGGGACCCGGGTGTGGG + Intronic
927401915 2:22721458-22721480 CAGCATGGGGACCCTGGGCCCGG + Intergenic
928804389 2:35132744-35132766 CAGCACGGGGATCCTTGGCCTGG + Intergenic
929528854 2:42732457-42732479 CAGCACAGGGACCCTGGGCCTGG + Intronic
930280464 2:49362863-49362885 CAGCATGGGGACCCTGGGCCCGG + Intergenic
930484807 2:51998724-51998746 CAGCACAGGGACCCTGGGCCTGG - Intergenic
930558523 2:52930037-52930059 CAGCAAGGGGACCCTGGGCCTGG + Intergenic
931035730 2:58241026-58241048 CAGCGCGGCGACCACCGGGGTGG + Intronic
931512783 2:63019460-63019482 CAGCACTGGGAGGCCCAGGCGGG + Intronic
931734632 2:65182666-65182688 CAGCATGGGGACCCTGGGCCTGG - Intergenic
932960611 2:76408705-76408727 CAGCACGGGGACCCTGGGCCTGG - Intergenic
934610615 2:95732565-95732587 CAGCATGGGGACCCTGGGCCCGG + Intergenic
936169345 2:110155044-110155066 CAGCATGGGGACCCTCGGCCTGG - Intronic
936543956 2:113374147-113374169 CAGCATGGGGACCCTCGGCCTGG + Intergenic
936753675 2:115678303-115678325 CAGCAGGGGGGCCCCGGGCCTGG - Intronic
936827759 2:116602729-116602751 CAGCACGGGGACCCTGGGCAAGG - Intergenic
937444844 2:121949245-121949267 CAGCACTGGGAGGCCCAGGCGGG - Intergenic
938970207 2:136424677-136424699 CTGCATGGGGTGCCCCGGGCTGG + Intergenic
939224982 2:139353682-139353704 CAGCACGGGGACCCTGGACCTGG - Intergenic
939667586 2:144969743-144969765 CAGCACAGGGACCCTGGGCCTGG + Intergenic
939762384 2:146198902-146198924 CAGCACGGGGGCCCTGGGCCTGG - Intergenic
939847826 2:147269114-147269136 CAGCACGGGGACCCTGGGCCTGG + Intergenic
941289947 2:163662612-163662634 CAGCACTGGGACCCTGGGCCCGG - Intronic
942054252 2:172167860-172167882 CAGCACAGGGACCCTGGGCCCGG - Intergenic
942387791 2:175460615-175460637 CAGCACAGGGACCCTGGGTCTGG - Intergenic
942805838 2:179930156-179930178 CAGCATGGGGACCCCAGGCCCGG + Intergenic
942950049 2:181712082-181712104 CAGCATGGGGACCCTGGGCCCGG - Intergenic
943072241 2:183154128-183154150 CAGCACAGGGACCCTGGGCCTGG + Intronic
943491330 2:188559183-188559205 CAGCACAGGGACCCTGGGCCAGG - Intronic
943543314 2:189244033-189244055 CAGCATGGGGACCCTGGGCCAGG + Intergenic
943776711 2:191774206-191774228 CAGCACGGGGACCCTAGGCAGGG - Intergenic
944101394 2:196031301-196031323 CAGCACGGGGACCCTGGGCCTGG + Intronic
945089787 2:206168129-206168151 CAGCACGGGGACCCTGGGCCCGG + Intergenic
945234901 2:207625091-207625113 CAGCTCCGGGGCCCCCGGGCAGG - Exonic
945484733 2:210381932-210381954 CAGCACGGGGACCCTGGGCCTGG - Intergenic
945699468 2:213152011-213152033 CAGTCCGGGGACCAACGGGCTGG - Intronic
946228421 2:218277164-218277186 CAGCACTGGGACTCCCTGGCAGG - Intronic
946396352 2:219445504-219445526 CACCAAGGGGGCCCCCGGGTCGG - Intronic
946757529 2:222962720-222962742 CAGCACGAGGACCCTGGGCCTGG - Intergenic
947008479 2:225538554-225538576 CAGCACAGGGACCCTGGGCCTGG + Intronic
948189709 2:236048288-236048310 CAGCACTGGGACCCCAGAACTGG - Intronic
948599943 2:239102089-239102111 CAGAACGTGGACCCCGGGCCGGG - Intronic
1169858031 20:10124409-10124431 CAGCATGGGGACCCTGGGCCGGG + Intergenic
1169999284 20:11596698-11596720 TAGCACGGGGACCCTGGGCCCGG + Intergenic
1170026069 20:11891003-11891025 CAGCGCGGGACCGCCCGGGCAGG + Intronic
1170499665 20:16961443-16961465 CAGCACAGGGACCCTGGGTCTGG + Intergenic
1170999084 20:21396081-21396103 CAGCACGCCCACCCCCGGCCAGG - Exonic
1171118746 20:22549748-22549770 CAGCACGGGGACCCTGGACCTGG + Intergenic
1171130149 20:22644746-22644768 CAGCATGGGGACCCTGGGCCTGG + Intergenic
1171824026 20:29878426-29878448 CATCCCGGGGATCCCAGGGCCGG - Intergenic
1171896042 20:30811910-30811932 CATCCCGGGGATCCCAGGGCCGG + Intergenic
1171972526 20:31573157-31573179 GGGCAGGGGGGCCCCCGGGCCGG + Intronic
1172146612 20:32762307-32762329 CGGCGGGGGCACCCCCGGGCGGG + Intergenic
1172837771 20:37883964-37883986 CAGCACTGGGAAGCCAGGGCGGG + Intergenic
1172971388 20:38875464-38875486 CAGGACAGGGCCCCCCAGGCAGG + Intronic
1174535432 20:51247765-51247787 CAGCGCTGGGACCCCAGTGCAGG - Intergenic
1175008456 20:55710667-55710689 CAGCACAGGGACCCTAGGCCTGG - Intergenic
1176128864 20:63487902-63487924 CTGCCCGGGGACCCCAGGGTGGG - Intergenic
1176173840 20:63708394-63708416 CAGCCCGGGTACCCCCGCTCAGG - Intronic
1177118187 21:17110249-17110271 CAGCATGGGGACCCTGGGTCTGG + Intergenic
1177130404 21:17248278-17248300 CAGCATGGGGACCCTGGGGCCGG - Intergenic
1177266978 21:18798311-18798333 CAGCATGGGGACCCAGGGCCTGG - Intergenic
1177473943 21:21594225-21594247 CAGCATGGGGACCCTGGGCCTGG + Intergenic
1177839248 21:26218102-26218124 CAGCATGGGGACCCTGGGCCTGG - Intergenic
1178011367 21:28290370-28290392 CAGCAGGGGGACCCTGGGCCTGG + Intergenic
1179605589 21:42513687-42513709 CAGCCCCGGGGCCACCGGGCGGG - Intronic
1179728017 21:43351031-43351053 CGGCACGGGGTCCCCCAGCCCGG + Intergenic
1179793183 21:43767576-43767598 CAGCACAGCGACCCCGAGGCTGG + Intergenic
1179957889 21:44751368-44751390 CAGCACAGGGACCCTGGCGCTGG - Intergenic
1180170719 21:46056892-46056914 CAGCACAGAGACCCCCGGGCCGG - Intergenic
1180832131 22:18911755-18911777 CAGCAGGGGGAACCCCCTGCGGG - Exonic
1180908615 22:19432492-19432514 CAGCAGGGGGCACCGCGGGCCGG + Exonic
1181017806 22:20081112-20081134 CAACACTGGGTACCCCGGGCTGG - Intronic
1181067105 22:20311923-20311945 CAGCACTGGGTCCCCCAGCCTGG - Intergenic
1181067712 22:20314587-20314609 CAGCAGGGGGAACCCCCTGCGGG + Exonic
1181106523 22:20579024-20579046 CAGCACGGGGGCCCAGGGGGTGG + Intronic
1181604238 22:23970814-23970836 CAGCCTGGGGACCCCTGGGCTGG + Intronic
1181956194 22:26589655-26589677 GCGCGCGGGGACCCCCAGGCGGG - Intronic
1182283424 22:29231085-29231107 CAGGAGGGGGACCCCAGAGCGGG - Exonic
1183079630 22:35448139-35448161 CAGCATGAGGACCTCAGGGCCGG + Intergenic
1183359391 22:37375648-37375670 CAGCACGGGGGCCCCAGGCAAGG + Exonic
1184278899 22:43426193-43426215 CAGCAAGGAGAGCCCCGGGCTGG - Intronic
1185372148 22:50465880-50465902 CAGCACGGGGAGCCTAGAGCCGG - Intronic
1185395281 22:50583477-50583499 CTACACGGGGACTCCCTGGCCGG + Intronic
1203282216 22_KI270734v1_random:137060-137082 CAGCAGGGGGAACCCCCTGCGGG - Intergenic
949369462 3:3318588-3318610 CAGCACAGGGACCCTGGGCCTGG + Intergenic
950181226 3:10914866-10914888 CAGCATGGGGACCTCTGTGCTGG + Intronic
950800709 3:15550089-15550111 CAGCACGGGGACCCTGGACCCGG - Intergenic
950843283 3:15988345-15988367 CAGCACGTGGACCCTGGGCCTGG + Intergenic
951058261 3:18173227-18173249 CAGCATGGGGACCCTGGGCCTGG + Intronic
951358980 3:21702393-21702415 CAGCACGGGAACCCTGGGCCCGG + Intronic
951756480 3:26096615-26096637 CAGCACGGGGACCCTGGGCCTGG + Intergenic
951793979 3:26517714-26517736 CAGCACAGGGACCCTGGGCCTGG - Intergenic
952541247 3:34370542-34370564 CAGCACAGGGACCCTGGGGCCGG - Intergenic
952831442 3:37568295-37568317 GAGCAGGGGGACCCCAGGCCTGG + Intronic
952943361 3:38459647-38459669 CAGGCCGGGGACACCAGGGCAGG + Intronic
953982520 3:47419784-47419806 CAGCACAGGGACCTCAGGCCTGG + Intronic
954605864 3:51908728-51908750 CAGCACAGGGAGCCAGGGGCTGG + Intergenic
957939945 3:86991325-86991347 CTGCAGGGGGACCCCGGGGAAGG + Intergenic
958956499 3:100470166-100470188 CAGCATGGGGACCCTGGGCCTGG + Intergenic
959591986 3:108091269-108091291 GAGCACGCGGACCCCAGGGGCGG - Intergenic
959754762 3:109883945-109883967 CAGCACGGGGATCCTGGGCCTGG + Intergenic
959872181 3:111341235-111341257 CAGCATGGGGACCCTGGGCCAGG - Intronic
959973385 3:112431847-112431869 CAGCACAGGGACCCTGGGACTGG - Intergenic
960496702 3:118383933-118383955 CAGCACAGGGACCCTGGGCCTGG - Intergenic
961257757 3:125571544-125571566 CAGCATGGGGACCCTAGGCCCGG - Intronic
961831140 3:129623587-129623609 CAGCAAGGGGTCCCCAGGCCAGG + Intergenic
962023839 3:131527055-131527077 GAGCTGGGGGACACCCGGGCCGG + Intergenic
962339527 3:134570066-134570088 CAGCATGGGGACCCTGGGCCTGG + Intronic
962344772 3:134610955-134610977 CTGCAGGGGAACCCCGGGGCAGG + Intronic
962672868 3:137726787-137726809 CAGCACAGGGACCCTGGGCCTGG + Intergenic
962974255 3:140432452-140432474 CAGCAGCGTGACCCCAGGGCAGG + Intronic
963716648 3:148811499-148811521 CAGCACAGGGACCCTGGGCCCGG - Intronic
964098638 3:152962864-152962886 CAGCATGGGGACCCTGGGCCAGG + Intergenic
964201326 3:154121850-154121872 CAGCAGGGGGACCGCCGGTCTGG + Intronic
965127509 3:164649529-164649551 CAGCATGGGGACCCTGGGCCTGG - Intergenic
965198814 3:165631142-165631164 CAGCAAGGGGCCCCCGGGCCTGG - Intergenic
965386860 3:168056095-168056117 CAGCACAGGGACCCTGGGCCTGG - Intronic
965458221 3:168930119-168930141 CAGCACTGGGACCCTGGGCCTGG + Intergenic
966886531 3:184380398-184380420 CAGCACGGGGGGCTCTGGGCCGG - Exonic
966933610 3:184691503-184691525 CAGCACCCGGAGCCCCGGGAAGG + Intergenic
967908278 3:194519966-194519988 CAGCACGGAGACCCTGGGCCTGG - Intergenic
968161628 3:196432014-196432036 CGGCCCGGGGACCCGGGGGCGGG - Intronic
968749693 4:2381904-2381926 CAGCACAGGGACCCTGGGCCTGG - Intronic
969682229 4:8649754-8649776 CTGCCCGGGGCCCCCGGGGCCGG + Intergenic
970222484 4:13825226-13825248 CAGCATGGGGACCCTGGGCCAGG - Intergenic
970382148 4:15518848-15518870 CAGCATGGGGACCCTAGGCCTGG + Intronic
970426934 4:15954242-15954264 CAGCATGGGGACCCTGGGCCTGG + Intergenic
970624444 4:17861449-17861471 CAGCACGGGGACCCTGGGCCTGG + Intronic
971510428 4:27417190-27417212 CAGCACAGGGACCCTGGGCCTGG - Intergenic
971600147 4:28582017-28582039 CAGCACGGGGATCCTGGGCCTGG - Intergenic
971743586 4:30551317-30551339 CAGCATGAGGACCCCAGGCCTGG - Intergenic
972329332 4:38049816-38049838 ACCCCCGGGGACCCCCGGGCAGG - Exonic
972467476 4:39371156-39371178 CAGCACGGGGACCCTGGGCCTGG - Intergenic
973107741 4:46361264-46361286 CAGCAGGGGGACCCTCGGCCAGG - Intronic
973613419 4:52658250-52658272 CAGCCTGGGGACCCAAGGGCTGG + Intronic
973718462 4:53700601-53700623 CAGCACAGGGACCCTGGGACTGG + Intronic
974171227 4:58269942-58269964 CAGCAGGGGGACCCTGGGCCTGG - Intergenic
975186485 4:71409834-71409856 CAGCACGGGGACCCCGGGTGTGG - Intronic
975542928 4:75532858-75532880 CAACACGGGGACCCTGGGCCTGG + Intronic
975729261 4:77321443-77321465 CAGCACAGGGACCCTGGGCCTGG + Intronic
975942106 4:79660324-79660346 CAGCACGGGGACCCTAGGCCTGG - Intergenic
976051597 4:81016770-81016792 CAGCACGGGGACCCTTGGCCCGG + Intergenic
976286463 4:83375680-83375702 CAGCACAGGGACCCTGGGCCTGG + Intergenic
976405641 4:84658311-84658333 CAGCATGGGGACCCTGGGTCTGG + Intergenic
977070332 4:92376895-92376917 CAGCATGGGGACCCTGGGTCTGG + Intronic
977339827 4:95744253-95744275 CAGCACTGGGACCCTGGGCCTGG - Intergenic
979411440 4:120384465-120384487 CAGCATGGGGACCCTAGGCCTGG - Intergenic
979464679 4:121022476-121022498 CAGCATGGGGACCCTGGGCCTGG + Intergenic
980308832 4:131100806-131100828 CAGCACGGGGACCCTCAGCCCGG - Intergenic
981531784 4:145761115-145761137 CAGGAGCGGGGCCCCCGGGCCGG + Exonic
981799371 4:148637610-148637632 CAGCACAGGGACCCTGGGCCTGG + Intergenic
982192905 4:152876757-152876779 CAGCACAGGGACCCTGGGCCTGG - Intronic
982279109 4:153665900-153665922 CAGCATGGGGACCCTGGGCCTGG - Intergenic
982868237 4:160544259-160544281 CAGCACTGGGACCCTGGGTCTGG + Intergenic
983489152 4:168368211-168368233 CAGCACAGGGACCCTGGGCCTGG - Intronic
985201391 4:187488688-187488710 CAGCACAGGGACCCAGGGCCTGG - Intergenic
985337740 4:188914253-188914275 CAGCACAGGGACCCTGGGCCTGG + Intergenic
985492282 5:186907-186929 CAGTACTGGGACCCCCAGGAAGG + Exonic
985629960 5:1009076-1009098 AAGCACGGTGAGCCGCGGGCCGG + Exonic
986113961 5:4750797-4750819 CAGCATGGGGCCCCTCGGCCTGG + Intergenic
986729329 5:10623681-10623703 CAGCACGGCTACCCCTGGGTGGG - Intronic
987792095 5:22581237-22581259 CAGCACAGGGACCCTGGGCCTGG - Intronic
988149934 5:27364519-27364541 CAGCACAGGGACCCTGGGCCTGG - Intergenic
988426884 5:31074495-31074517 CAGCACAGGGACCCTGGGCCAGG + Intergenic
988804466 5:34727561-34727583 CAGCAAGGGGGCCCCAGGCCTGG - Intronic
989389158 5:40882488-40882510 CAGCATGGGGACCCTGGGCCTGG - Intergenic
989457246 5:41658357-41658379 CAGCAGGGGTACCCCTGGTCAGG + Intergenic
989532529 5:42524734-42524756 CAGCACAGGGACCCTGGGCCTGG - Intronic
990075781 5:51844086-51844108 CAGCACAGGGACCCTGGGCCGGG + Intergenic
990844605 5:60122604-60122626 CAGCACGGGGACCCTGGGCCTGG + Intronic
992651587 5:78865425-78865447 CAGCACAGGGACCCTAGGCCTGG + Intronic
992769689 5:80035466-80035488 CGGCCCGGGGACCCCCAGGCGGG + Exonic
993098304 5:83506024-83506046 CAGCACGGGGACCCTGGGCCTGG + Intronic
993293773 5:86108938-86108960 CAGCACAGGGACCCTGGGCCTGG - Intergenic
993430980 5:87831699-87831721 CAGCATGGGGACCCTAGGCCCGG + Intergenic
993442456 5:87973512-87973534 CAGCATGGGGACCCTGGGCCTGG + Intergenic
993893741 5:93505746-93505768 CAGCATGGGGACCCTGGGCCTGG + Intergenic
994637718 5:102363578-102363600 CAGCACAGGGACCCTGGGCCAGG + Intergenic
994649046 5:102504161-102504183 CAGCATGGGGACCCTGGGCCCGG - Intergenic
994823290 5:104680559-104680581 CAGCATGGGGACCCTGGGCCTGG - Intergenic
994831206 5:104785967-104785989 CAGCACGGGGACCCTGGGCCTGG - Intergenic
994849514 5:105036179-105036201 CAGCAAGGGGACCCTTGGCCTGG + Intergenic
994900461 5:105762913-105762935 CAGCATGGGGACCCGTGGCCTGG + Intergenic
995702793 5:114955068-114955090 CAGCAGGGGGACCCTAGGCCTGG - Intergenic
996033571 5:118733613-118733635 CAGCATGGGGACCCTGGGCCTGG - Intergenic
996179939 5:120406976-120406998 CAGCACAGGGACCCAGGGCCTGG - Intergenic
996636105 5:125691924-125691946 CAGCATGGGGACCCTGGGCCTGG - Intergenic
996641599 5:125761595-125761617 CAGCACAGGGACCCTGGGCCTGG - Intergenic
997092934 5:130878372-130878394 CAGCACGGAGACCCTGGGACCGG - Intergenic
997297435 5:132776962-132776984 CAGCTCGAGGACCCCGGCGCGGG - Intronic
997749690 5:136332167-136332189 TAGCACGGGGACCCTCTGTCTGG - Intronic
998813965 5:145993702-145993724 CAGCACGGGGACCCTGGGCCCGG + Intronic
999669403 5:153945358-153945380 CAGCACAGGGACCCTGGGCCTGG + Intergenic
999768328 5:154756574-154756596 CAAAACGGGGAGCGCCGGGCGGG - Intronic
999804925 5:155072310-155072332 CAGCATGGGGACCCTGGGACTGG + Intergenic
1000226492 5:159266691-159266713 CAGCGCGGGGACCCTGGGCCGGG - Intronic
1000229135 5:159298593-159298615 CAGCATGGGGACCCTGGGCCTGG + Intergenic
1001181692 5:169526392-169526414 CAGCACAGGGACCCCTGGCCTGG + Intergenic
1001638174 5:173227624-173227646 CAGCCCTGGGGACCCCGGGCAGG - Intergenic
1002133380 5:177094593-177094615 CAGCAAGAGCACCCCGGGGCTGG - Intronic
1002212490 5:177607217-177607239 CACCATGGGGACCCCCGGGTGGG + Intronic
1002961093 6:1915436-1915458 CAGCAGGGGCAGCCCAGGGCCGG + Intronic
1003227914 6:4223262-4223284 CAGCATGGGGACCCTAGGCCTGG - Intergenic
1003360587 6:5421300-5421322 CAGCATGGGGACCCTGGGCCTGG + Intronic
1005655298 6:27929307-27929329 CAGCACGGGTACCCTGGGCCTGG + Intergenic
1006073202 6:31511646-31511668 CAGCACCAGGACCCCCTGGCAGG - Intergenic
1006113269 6:31761634-31761656 CTCCTCGGGGACCCCCAGGCTGG + Intronic
1006316761 6:33296093-33296115 CAGCAGGGGGATCGCCGGGGAGG + Exonic
1006878850 6:37321687-37321709 CAGCAGGGAGCCCCCAGGGCTGG + Intronic
1008650064 6:53552741-53552763 CAGCACGGAGACCCTGGGCCTGG - Intronic
1009980494 6:70720814-70720836 CAGCATGGGGACCCTGGGCCCGG + Intronic
1010884330 6:81217969-81217991 CAGCACAGGGACCCTGGGCCTGG - Intergenic
1012196033 6:96342228-96342250 CAGCACGGGGACCCTGGTCCTGG + Intergenic
1012436440 6:99219943-99219965 CAGCAGGGGGAGTCCTGGGCTGG - Intergenic
1012649639 6:101736630-101736652 CAGCATGGGGACCCTGGGCCCGG + Intronic
1013086612 6:106863056-106863078 CAGCACAGGGACCCTGGGCCTGG - Intergenic
1013838293 6:114359215-114359237 CAGCTCGGGGACCTCAGGGAAGG - Intergenic
1013863110 6:114660373-114660395 CAACACGGGGACCCTGGGCCTGG - Intergenic
1014482483 6:121955024-121955046 CAGCATGGGGACCCTAGGACTGG + Intergenic
1014863276 6:126496795-126496817 TAGCACGGGGACCCTAGGCCAGG + Intergenic
1015815648 6:137208469-137208491 CAGCACGGGGACCCTGGGCCTGG - Intronic
1016987860 6:149908686-149908708 CAGCAGGGGGACCCTGGGCCTGG - Intergenic
1017231328 6:152077120-152077142 CAGCATGGGGACCCTGGGACTGG - Intronic
1017547581 6:155468469-155468491 CAGCACAGGGACCCTGGGCCTGG + Intergenic
1018866936 6:167753513-167753535 CAGCACAGGGACCCTGGGCCTGG + Intergenic
1018890560 6:167978472-167978494 CCGCCCGGGGACACCCGGGGTGG + Intergenic
1018947291 6:168356685-168356707 CAGCAGGGGCAGCCCCAGGCAGG + Intergenic
1019112169 6:169724686-169724708 CGGGGCGGGGACCCCCGGGAGGG - Intronic
1019158040 6:170051973-170051995 CTGCACTGTGACCTCCGGGCGGG + Intergenic
1020007612 7:4790815-4790837 CAGCACGGTGACCACCTGGGGGG - Exonic
1020037724 7:4974668-4974690 CAGCGCCCGGACCCCCGAGCCGG - Intergenic
1020252976 7:6484084-6484106 CAGCGCGGCGGCCCCGGGGCTGG + Exonic
1020782732 7:12536421-12536443 CAGCACGGGGACCCTGGTCCTGG + Intergenic
1020837245 7:13168604-13168626 CAGCATGGGGACCCTGGGCCAGG + Intergenic
1024062632 7:45710311-45710333 CTGCACGGGCTCCCCTGGGCAGG - Intronic
1024814825 7:53256666-53256688 CAGCACAGGGACCCTGGGCCTGG - Intergenic
1026278654 7:68902694-68902716 CAGCACGGGGACCCTGGGCCAGG - Intergenic
1026532529 7:71212143-71212165 CAGCACAGGGACCCTGGGCCAGG - Intronic
1027458562 7:78424130-78424152 CAGCAGGGGGACCCTTGGCCTGG - Intronic
1028291840 7:89075318-89075340 CAGCACAGGGACCCAGGGCCTGG - Intronic
1029269066 7:99365702-99365724 CAGCAGGGGGAGCCCCGGCCTGG + Intronic
1029694690 7:102204979-102205001 GGGCATGGGGACCCACGGGCCGG - Intronic
1030967032 7:116005839-116005861 CAGCATGGGGACCCTGGGACTGG - Intronic
1031158148 7:118135261-118135283 CAGCATGGGGACCCTGGGCCCGG - Intergenic
1031783267 7:125997380-125997402 CAGCACTGGGACCCTGGGCCTGG - Intergenic
1033419757 7:141195019-141195041 CAGCACGGGGACCCTGGGCCTGG + Intronic
1033735124 7:144214725-144214747 CAGCATGGGGACCCTGGGCCTGG - Intergenic
1033747932 7:144336244-144336266 CAGCATGGGGACCCTGGGCCTGG + Intergenic
1033833037 7:145276321-145276343 CAGCACAGGGACCCTGGGCCAGG - Intergenic
1034195005 7:149239728-149239750 CAGCACGGGGGCTCCGAGGCGGG + Exonic
1034343503 7:150372215-150372237 CAGCTGGGGGCTCCCCGGGCCGG - Exonic
1034623043 7:152471198-152471220 CAGCATGGGGACCCTGGGCCTGG - Intergenic
1034981905 7:155484577-155484599 CAGCACGGGGACCCATGGAGGGG - Intronic
1035167468 7:157000117-157000139 GAACCCGGGGACCCCCGCGCTGG + Intronic
1035670621 8:1414472-1414494 CTGCACTGGGACCCCCGGCCTGG - Intergenic
1035750724 8:1994258-1994280 CAGCACTGGGATCCTGGGGCAGG - Intronic
1035951845 8:4030533-4030555 CAGCATGGGGACCCTTGGCCCGG + Intronic
1037262905 8:17027532-17027554 CTGTACGGGGACCCCAGGGCCGG + Exonic
1037573623 8:20179956-20179978 CAGCTCTGGGACCCCTGGACAGG + Intronic
1037882278 8:22579099-22579121 CAGGTCCGGGAGCCCCGGGCGGG + Exonic
1037987047 8:23296517-23296539 CAGTTCTGGGACCCCTGGGCTGG + Intergenic
1038110871 8:24496052-24496074 CAGCACGGGGACCCTGGGCCTGG - Intronic
1038400869 8:27283758-27283780 CAGCCCAGGGAGCCCCGGGCAGG + Intergenic
1038575831 8:28702258-28702280 CAGCACCTGGACCCTCGGACAGG - Intronic
1039843249 8:41308507-41308529 CAGCACCGGGACCCAGCGGCGGG + Intronic
1041497531 8:58503335-58503357 CAGCAGGGGGACCCTGGGCCTGG - Intergenic
1042992330 8:74655408-74655430 CAGCATGGGGACCCTGGGCCAGG - Intronic
1043694726 8:83204383-83204405 CAGCATGGGGACCCTGGGTCCGG - Intergenic
1044784668 8:95781520-95781542 CAGCACAGGGACCCTGGGCCTGG - Intergenic
1045545202 8:103122464-103122486 CAGCTCTGGGATCCCTGGGCAGG + Intergenic
1046207115 8:111015227-111015249 CAGCATGGGGACCCTGGGCCTGG - Intergenic
1046305279 8:112357618-112357640 CAGCATGGGGACCCTGGGCCTGG - Intronic
1046703260 8:117424249-117424271 CAGCATGGGGACCCTGGGCCTGG + Intergenic
1047149124 8:122241130-122241152 CAGCACTGGGACCCTGGGCCCGG - Intergenic
1047194884 8:122712492-122712514 CAGCACAGGGACCCTGGGCCTGG - Intergenic
1048772811 8:137913154-137913176 CAGCACAGGGACCCTGGGTCTGG + Intergenic
1048895810 8:138991055-138991077 CAGCATGGGGACCCTGGGCCGGG + Intergenic
1049223816 8:141440268-141440290 CAACACGCGGACCTCAGGGCTGG + Intergenic
1049536498 8:143184816-143184838 CAGCCCAGGGACCCCCTGGTTGG - Intergenic
1050264083 9:3871689-3871711 CAGCACAGGGACCCTGGGCCAGG + Intronic
1051860859 9:21623348-21623370 CAGCAAGGGGACCCTGGGCCTGG + Intergenic
1052351808 9:27465879-27465901 CAGCACGGGGATCCTGGGACCGG + Intronic
1053526321 9:38833988-38834010 CAGCAGGGAGACACCAGGGCAGG - Intergenic
1054198547 9:62058413-62058435 CAGCAGGGAGACACCAGGGCAGG - Intergenic
1054337178 9:63817524-63817546 CATCCCGGGGATCCCAGGGCCGG - Intergenic
1054639806 9:67529950-67529972 CAGCAGGGAGACACCAGGGCAGG + Intergenic
1055080858 9:72266367-72266389 CAGCACGGGGACCCTGGTCCTGG + Intergenic
1055341935 9:75293202-75293224 CAGCACGGGGACCCTAGGCCCGG + Intergenic
1055363943 9:75524657-75524679 CAGCACAGGGACCCTGGGCCTGG - Intergenic
1056087019 9:83160779-83160801 CAGCACAGGGACCCTGGGCCTGG - Intergenic
1057230066 9:93316744-93316766 CACCACGGGGATCTCCAGGCGGG - Intronic
1059048367 9:110895431-110895453 CAGCACGGGGCCCCCTAGTCAGG + Intronic
1059482344 9:114601066-114601088 CAGCACAGGGACCCTGGGCCTGG + Intergenic
1059587284 9:115619865-115619887 CAGCACGGGGACCCTGGGCCTGG + Intergenic
1060525808 9:124320659-124320681 CAGAACGGTGCCCCCCTGGCTGG - Intronic
1060653660 9:125352551-125352573 CAGCATGGGGACCCTGGGCCTGG + Intronic
1060973969 9:127754339-127754361 GAGCGCGGAGACCCCCGGACAGG + Intronic
1061309476 9:129752857-129752879 CAGGCCGGGGACCCCCAGGGAGG + Intronic
1061913874 9:133738949-133738971 CAGCACGTAGCCCCCAGGGCAGG + Intronic
1062031431 9:134363766-134363788 GAGCATGGGGACCCCAGGGCCGG + Intronic
1062031444 9:134363800-134363822 GAGCATGGGGATCCCGGGGCCGG + Intronic
1062043969 9:134416687-134416709 CAGCACAGGGGCACCCGTGCTGG - Intronic
1062395568 9:136351303-136351325 GATCACCGGGACCCCCGGGAAGG - Intronic
1062440739 9:136568207-136568229 CTGCACCCGGATCCCCGGGCTGG - Intergenic
1062600859 9:137318083-137318105 CGGCACTGGGGCCCCCAGGCTGG + Intronic
1186032981 X:5390657-5390679 GAACACGGTGACACCCGGGCAGG + Intergenic
1186324023 X:8459167-8459189 CAGCACGGGGACCCTGGGCCTGG + Intergenic
1186742578 X:12534050-12534072 CAGCACGGGAACCCTGGGCCTGG - Intronic
1186992404 X:15084375-15084397 CAGCACGGGGAACCTGGGCCTGG - Intergenic
1188748255 X:33873507-33873529 CAGCAGGGGGACCCTGGGTCTGG + Intergenic
1189028864 X:37429065-37429087 CAGCATGGGGACCCTGGGCCTGG + Intronic
1191202865 X:57803371-57803393 CAGCACAGGGACCCTGGGCCTGG - Intergenic
1191856161 X:65628505-65628527 CAGCTCAGGGACCCTGGGGCTGG + Intronic
1192270577 X:69575503-69575525 AAGCACGGGGACCCTGGGCCTGG + Intergenic
1192309397 X:69997705-69997727 CAGCACAGGGACCCTGGGCCTGG - Intronic
1192496127 X:71617690-71617712 CGGCCCAGGGACCCCTGGGCAGG + Exonic
1193188324 X:78539292-78539314 CAGCATGGGGACCCTTGGCCTGG + Intergenic
1193279331 X:79628501-79628523 CAGCATGGGGACCCTAGGCCGGG - Intergenic
1193438957 X:81515442-81515464 CAGCACAGGGACCCTGGGCCTGG - Intergenic
1193813769 X:86082153-86082175 CAGCATGGGGACCCTGGGCCCGG + Intergenic
1193842059 X:86418615-86418637 CAGCACGTGGACCCTGGGCCTGG + Intronic
1193962822 X:87947123-87947145 CAGCATGGGGACCCTGGGCCTGG - Intergenic
1194215827 X:91129132-91129154 CAGCATGGGGACCCTGGGCCCGG + Intergenic
1194503850 X:94708753-94708775 CAGCACAGGGACCCTGGGCCCGG + Intergenic
1195554896 X:106210638-106210660 CAGCACGGAGACCCTGGGCCTGG + Intergenic
1196036410 X:111149717-111149739 CAGCACGGGGACCCTGGAGCTGG + Intronic
1196567887 X:117230067-117230089 CAGCACGGTGACCCTAGGCCTGG + Intergenic
1197160605 X:123318156-123318178 CAGCACGGGGACCCTGGGCCTGG + Intronic
1197431913 X:126376974-126376996 CAGCACGGGGACCCTGGGCCTGG + Intergenic
1197547086 X:127838550-127838572 CAGCACAGGGACCCTGGGCCTGG + Intergenic
1197642858 X:128985998-128986020 CAGCATGGGGACCCTGGGCCTGG - Intergenic
1198734583 X:139772072-139772094 CAGCACGGGGACGCTGGGCCTGG - Intronic
1199325460 X:146493481-146493503 CAGCATGGGGACCCTGGGCCTGG - Intergenic
1199623681 X:149721311-149721333 CAGCATGGGGACCCCTCGCCTGG - Intergenic
1200100198 X:153686361-153686383 CAGCTCTGGGAGCCGCGGGCAGG - Intronic