ID: 1132520335

View in Genome Browser
Species Human (GRCh38)
Location 16:384297-384319
Sequence CAAGTTCACCAGCCCTCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 151}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132520335_1132520339 2 Left 1132520335 16:384297-384319 CCAGCTGAGGGCTGGTGAACTTG 0: 1
1: 0
2: 2
3: 13
4: 151
Right 1132520339 16:384322-384344 GGTGGGTAAGAATCCCCAGACGG 0: 1
1: 0
2: 0
3: 11
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132520335 Original CRISPR CAAGTTCACCAGCCCTCAGC TGG (reversed) Intronic
900394257 1:2446700-2446722 CAGGTTGGCCAGCTCTCAGCTGG - Intronic
900687555 1:3958398-3958420 CCAGTTCACCACCTCTCAGGAGG + Intergenic
901338596 1:8473750-8473772 TAACACCACCAGCCCTCAGCTGG + Intronic
903577819 1:24350131-24350153 CTAGTTCACCCTCCCCCAGCTGG + Intronic
903626051 1:24730823-24730845 CGAGTTCCCCAGCTCTGAGCCGG - Intergenic
905732134 1:40304552-40304574 CAACCTCAGCAGCTCTCAGCAGG + Intronic
907079980 1:51612687-51612709 CAGGGTCACCAGGCATCAGCAGG - Intronic
908574063 1:65440623-65440645 CAAGTGCAGCGGCCCTGAGCTGG + Intronic
910216715 1:84850953-84850975 CCATCTCACCAGCCCACAGCGGG - Intronic
914724278 1:150314400-150314422 CCAGTCCACCAGCATTCAGCTGG + Intergenic
915203435 1:154251246-154251268 CCAGTCCTCTAGCCCTCAGCCGG + Exonic
916438295 1:164797249-164797271 CAAGTGCACCAGCTCTCAGCTGG - Intronic
920186069 1:204160247-204160269 CAAGTTCACCAGCTCTGACTGGG - Intronic
1062858273 10:790379-790401 CAAGCTGGTCAGCCCTCAGCAGG + Intergenic
1067069934 10:43123987-43124009 GAAGCCCACCAGCCCTCAGTGGG - Intronic
1070389239 10:75954266-75954288 CAACTGCTCCACCCCTCAGCTGG - Intronic
1070577400 10:77689618-77689640 CAAGTTCAGAAGCCCACAGGAGG + Intergenic
1071928182 10:90435611-90435633 CAAGTTCTCCAGCCTTCTGGAGG - Intergenic
1072799117 10:98380578-98380600 CACGCTCACAAGCCCACAGCCGG + Intergenic
1074533745 10:114314014-114314036 CAAGGACCACAGCCCTCAGCTGG - Exonic
1074820048 10:117171266-117171288 CAAGTTCTCCTGGCCACAGCAGG + Intergenic
1074892100 10:117744248-117744270 CAAGCTCCCCAGCCTTCAGTTGG + Intergenic
1076491067 10:130862037-130862059 CATCTTCCCCTGCCCTCAGCCGG - Intergenic
1076729799 10:132432547-132432569 CAAGCCCACCCGCCCTTAGCAGG + Intergenic
1077306200 11:1869726-1869748 CAAGCTCGCCAGCCCTCGCCTGG - Intronic
1078910607 11:15727721-15727743 CAAGTTCCCAAAACCTCAGCTGG + Intergenic
1079376190 11:19894307-19894329 CCAGTCAACCAGCCCTCAACAGG - Intronic
1082894344 11:58174127-58174149 CAAGCTCAACATCCCTGAGCAGG - Intronic
1083051163 11:59778054-59778076 CAAGTTCAATAGCCCTAAGTGGG - Intronic
1083274112 11:61587326-61587348 CCTGTTCCCCAGCCTTCAGCGGG + Intergenic
1084086894 11:66858991-66859013 CCAGCTCACCAGCCCTGAGGTGG - Exonic
1090947675 11:131446317-131446339 CAAATTCACCAGCCTGCAGATGG + Intronic
1095846789 12:46755101-46755123 CAATTCCACCACCCCACAGCAGG - Intergenic
1096420070 12:51449455-51449477 CAAAGTCACCTGCTCTCAGCAGG + Intronic
1100089880 12:90955485-90955507 CAAGTTCTCCCGCCCCCACCGGG - Intergenic
1101048947 12:100840939-100840961 TTAGGTCACCAGCCCTCATCAGG + Intronic
1101381016 12:104214120-104214142 CAAGTTCACTAAATCTCAGCTGG + Intergenic
1101875139 12:108592459-108592481 CAGGCTCACCAGCCCCCAGGAGG + Intronic
1102254707 12:111408773-111408795 CATGAACACCAGCCCTCAGAAGG - Intronic
1103925262 12:124420416-124420438 CAAGGACTCCAGCCCACAGCCGG + Intronic
1104230362 12:126878482-126878504 GAAGTTCACCAGGCTTCAACTGG - Intergenic
1104841068 12:131826183-131826205 CCAGTTCACCAGCCGCCACCAGG + Intergenic
1105002232 12:132697883-132697905 CGTGTTCACCTGCACTCAGCAGG + Intronic
1114031785 14:18585426-18585448 CAAGAACACCAGTCCTCAGGTGG - Intergenic
1114076557 14:19164455-19164477 CAAGAACACCAGTCCTCAGGTGG - Intergenic
1114085607 14:19235113-19235135 CAAGAACACCAGTCCTCAGGTGG + Intergenic
1114182574 14:20378618-20378640 CCAGTTACCCTGCCCTCAGCAGG + Intronic
1114184644 14:20391233-20391255 CAGCTTCAGCAGCCCTCAGGAGG + Intronic
1114363602 14:22003224-22003246 CAAGATCACAAGTCCTGAGCAGG - Intergenic
1118223506 14:63877454-63877476 CAAATTAACCACCTCTCAGCAGG - Intronic
1122160611 14:99781483-99781505 CCAGTTCCCCACCCCACAGCTGG + Intronic
1123965429 15:25451144-25451166 GATGTTCACAAGCCCTCATCAGG - Intergenic
1125797758 15:42416126-42416148 CAAATTCACAAACCCTCAGTGGG - Exonic
1129827711 15:78645528-78645550 CAGCTTCACCACCCCTCAGCTGG + Intronic
1132520335 16:384297-384319 CAAGTTCACCAGCCCTCAGCTGG - Intronic
1134021581 16:10924731-10924753 CAGATGCACCAGCCCTTAGCAGG + Exonic
1134648244 16:15888229-15888251 CAAGTCCTCCAGCCCCCGGCAGG + Intronic
1135288463 16:21214169-21214191 CAGCTTCACCAGCCCACAGCGGG - Intronic
1135544954 16:23359397-23359419 CTATTTCCCCAGCCCTCGGCAGG + Intronic
1137747642 16:50834860-50834882 CAAGTGGACCAGAACTCAGCGGG + Intergenic
1138068678 16:53968767-53968789 CAAGTAAACCAGTGCTCAGCTGG + Intronic
1138347628 16:56329762-56329784 CATTTTCACCAGGTCTCAGCTGG + Intronic
1139317175 16:66082943-66082965 CAAGTTCTCCAACCCTCAATGGG - Intergenic
1140699579 16:77568863-77568885 CAAGTGTACAAGCCCTGAGCTGG - Intergenic
1140751776 16:78030820-78030842 CGAGTTCACCATCCCTCAATAGG + Exonic
1143526599 17:7476755-7476777 CAGGTTCTCATGCCCTCAGCTGG + Intronic
1146846927 17:36187997-36188019 CAGGAGCACCAGCCCTCACCTGG + Intronic
1148136218 17:45293586-45293608 CAAGTTCAGCTGCCATCTGCTGG - Intronic
1157710036 18:49843878-49843900 CAACCTCCCTAGCCCTCAGCAGG - Intronic
1157794054 18:50559490-50559512 CAAGTGCACCGGTCCCCAGCCGG - Intergenic
1158350546 18:56561097-56561119 CAAGTTCCACAGCTCTAAGCAGG - Intergenic
1159087762 18:63813283-63813305 CAGCTACACCAGCACTCAGCTGG - Intergenic
1160147541 18:76377320-76377342 AAAGTTCACAAGTGCTCAGCGGG + Intronic
1160530067 18:79557427-79557449 CAGGCTCCCCAGCCCTCAGCAGG - Intergenic
1162818666 19:13210235-13210257 CAGGGCCACCAGCGCTCAGCTGG - Intronic
1166130827 19:40744665-40744687 CAAGGCCACCAGCCCGCATCTGG + Exonic
1167948853 19:53010604-53010626 CAAGTTCACCAGCCCCCTCCAGG + Intergenic
925151396 2:1617853-1617875 AGAGTGCACCAGCCCTCGGCTGG + Intergenic
925440615 2:3882384-3882406 CAAGTCCTGCATCCCTCAGCAGG + Intergenic
925835008 2:7935990-7936012 CAAATACACCAGGGCTCAGCTGG - Intergenic
927811077 2:26180439-26180461 GAAGGTCACCAGCCCACAGGTGG - Intronic
928466837 2:31530020-31530042 CGACTTCACCAGCCTACAGCAGG - Intronic
928906192 2:36370500-36370522 CAAGTTTTCCAGCCCTCAGTTGG - Intronic
930520244 2:52456861-52456883 TCAGTTCCCCAGCCCTCTGCAGG + Intergenic
931463895 2:62470529-62470551 CAAGTGCAGCTGCCTTCAGCTGG + Intergenic
931925819 2:67071390-67071412 GAATTTGACCAGCCCTCAGTTGG - Intergenic
932330240 2:70894583-70894605 CAGCTTCCCCAGCCCTCAGGTGG + Intergenic
935102080 2:100006637-100006659 CAAGTTCAGCATCCCCAAGCAGG - Exonic
935869616 2:107431951-107431973 CAAGTTCACCGGTCTGCAGCTGG + Intergenic
937587058 2:123565537-123565559 CAAGTTTTCCAGTCCTAAGCAGG - Intergenic
943107710 2:183567269-183567291 CAAGTTCACAATCTCTTAGCTGG - Intergenic
945760999 2:213915277-213915299 CTAGTCCCCCACCCCTCAGCAGG + Intronic
946461982 2:219876949-219876971 CAAGTTCCCCTGCCTGCAGCTGG - Intergenic
946606963 2:221416007-221416029 CAAATTCCCCACCCCTCAGGAGG + Intergenic
947527894 2:230890527-230890549 CCAGTTCACCCTCCCTCAGGTGG + Intergenic
947883983 2:233548366-233548388 CATGTTCACCTGCCATCTGCAGG + Intronic
948600916 2:239107065-239107087 CAAGGTCACCAGCTCCCAGACGG + Intronic
1171520298 20:25770555-25770577 CAAGGACACCAGGCCTCAGGTGG + Intronic
1171556621 20:26085938-26085960 CAAGGACACCAGGCCTCAGGTGG - Intergenic
1172300313 20:33845276-33845298 CTTGTTCACCATCACTCAGCAGG + Intronic
1176935012 21:14857533-14857555 CATGCTCACCTGCTCTCAGCTGG + Intergenic
1178216679 21:30606349-30606371 GAAGTTCCCCAGGCCTCAGGTGG - Intergenic
1179059551 21:37966903-37966925 CATGTTCCACAGCCCTCATCGGG + Intronic
1180292366 22:10858080-10858102 CAAGAACACCAGTCCTCAGGTGG - Intergenic
1180455899 22:15512483-15512505 CAAGAACACCAGTCCTCAGGTGG - Intergenic
1180495172 22:15887502-15887524 CAAGAACACCAGTCCTCAGGTGG - Intergenic
1181566782 22:23743611-23743633 CAAGCACGCCAGCTCTCAGCAGG - Exonic
1184100709 22:42340603-42340625 CAAGTACACAAGCACTCACCTGG + Intronic
1185028092 22:48426996-48427018 CAAGCGCACCAGACCTCAGCAGG - Intergenic
1185101626 22:48843717-48843739 CAAGGCCACCAGCCCACAGGAGG - Intronic
953461832 3:43087615-43087637 GAAGTTCCCCACCCCTCAGGAGG - Intronic
954031877 3:47825365-47825387 CAAGTTCGCCATCCGTCGGCGGG + Intronic
954109688 3:48427080-48427102 AAAGTTCTCCAGCCCTCAAGGGG + Intronic
956398383 3:68849837-68849859 CAACTTCAACAGCCCTCAACAGG + Intronic
956603829 3:71051558-71051580 CTTCTTCACCAGCCCTAAGCAGG - Intronic
956649919 3:71495149-71495171 CAAGTGCACCAGCCCTGAGATGG - Intronic
962854348 3:139330377-139330399 CAATATCACCTCCCCTCAGCTGG + Intronic
965784760 3:172324027-172324049 AGAGTTCACCTGCCCTAAGCTGG - Intronic
967958857 3:194902130-194902152 TAAGTTCACCAGCCCCAGGCAGG - Intergenic
969330179 4:6470365-6470387 TAAATTCACCAGCCCTCAGCAGG - Intronic
975562978 4:75724747-75724769 CAACTTCCCCCGCCCTCCGCAGG - Exonic
982441870 4:155444959-155444981 CAAGTGCATCTGTCCTCAGCTGG - Intergenic
985206682 4:187545672-187545694 CAACTTGACCACCCCTCAGTTGG + Intergenic
987217000 5:15747853-15747875 CAAGTTCAGCTGCCCCCAGGTGG - Intronic
989626828 5:43437698-43437720 CAAGTCCATCAGCCCTCTGCTGG - Intergenic
990032464 5:51278361-51278383 CTAGTCCACCACCCCTCAACAGG + Intergenic
995023802 5:107396516-107396538 CAACCTCAGAAGCCCTCAGCTGG - Intronic
996072574 5:119150314-119150336 CTAGTTTACCAGGACTCAGCCGG + Exonic
996762714 5:127002523-127002545 CAATTTCACCAGCCCCAAACTGG + Intronic
1001931261 5:175674660-175674682 CAAGCTCTGCAGCCCCCAGCGGG - Intronic
1001945272 5:175773022-175773044 TGGGTTTACCAGCCCTCAGCAGG - Intergenic
1003371348 6:5529991-5530013 AAAGTTCTTCAGCTCTCAGCTGG - Intronic
1007093906 6:39201588-39201610 CAATTTTACCATCCCTCCGCAGG - Intronic
1007996409 6:46312765-46312787 CAGTTTCACAAGCCCTCATCGGG + Intronic
1011072536 6:83401474-83401496 GAAGGTCACCAGCTCTTAGCAGG + Intronic
1011760314 6:90557756-90557778 AAAGTTCACCAGCCTTGAACAGG + Intronic
1026331818 7:69358681-69358703 CAAGTTCAGCAGTTGTCAGCAGG + Intergenic
1032717310 7:134520615-134520637 CTAGCTCCCCAGCCCCCAGCAGG - Intergenic
1033141953 7:138835296-138835318 CCGGATCACCAGCCCTCTGCTGG - Intronic
1033597791 7:142868985-142869007 CCAGTTCAGCAGCCTGCAGCTGG + Exonic
1033764109 7:144468957-144468979 GAGGTTCACCAACACTCAGCAGG - Intronic
1035207943 7:157306958-157306980 CAAGTCCACCAGGGCTCAGCGGG - Intergenic
1037801776 8:22039942-22039964 CAAGTTCAACACCCCCCAGCTGG - Intergenic
1038067620 8:23979474-23979496 AAAGTTCCAAAGCCCTCAGCAGG - Intergenic
1039476492 8:37841740-37841762 CAAGCTCACCAACCTGCAGCTGG + Exonic
1040074953 8:43220016-43220038 CGTGTTCACCAGCCACCAGCTGG + Intergenic
1041389778 8:57338239-57338261 AAAGTTCAGCAGCTCTCAGGTGG - Intergenic
1049263116 8:141650439-141650461 CCAGTTCACCAGCACACAACTGG - Intergenic
1049553814 8:143272547-143272569 CAGTTTCACCACCCCTCACCTGG - Intronic
1051149227 9:14062364-14062386 CAATCTCACCAACCCTCTGCCGG - Intergenic
1052096880 9:24393720-24393742 CTAGCTCCCCAGCCCTCAACAGG - Intergenic
1053298772 9:36934016-36934038 CATCTTCACCAGCCCACAGAGGG - Intronic
1055261358 9:74437568-74437590 CAAGTCAACCAGGCCTAAGCTGG + Intergenic
1057554088 9:96073757-96073779 CAAGTTGGCATGCCCTCAGCTGG + Intergenic
1059862017 9:118475405-118475427 CAAGATCAAAAGCACTCAGCGGG - Intergenic
1060101125 9:120842082-120842104 CAATTTCTGCAGCCCTCTGCAGG + Intronic
1060930977 9:127489414-127489436 ACAGACCACCAGCCCTCAGCAGG - Intronic
1061094306 9:128445839-128445861 CAAGCTCATCACCCCTCAGGTGG + Intergenic
1062381511 9:136289046-136289068 AAAGGTCACCTGCCCACAGCCGG + Intronic
1185727438 X:2433552-2433574 CTTGTTCCCCAGCCCCCAGCAGG + Intronic
1185800522 X:3006642-3006664 CAAGGTCATCTGCCATCAGCAGG - Exonic
1188005373 X:25012974-25012996 CACGTTCACCAGCTACCAGCTGG - Exonic
1188449096 X:30290284-30290306 CAAGTTCAACTGGCCTTAGCAGG - Intergenic
1189913375 X:45833744-45833766 CAAGCTCACCAGCCCAAAGCAGG + Intergenic
1192362639 X:70449247-70449269 CTAGTTCTCCAGGCCTCAGAAGG - Intronic
1198229578 X:134676298-134676320 AAAGTGCACCAGGCCTCGGCAGG - Intronic
1198694948 X:139325514-139325536 GAAGTTCCCCAGGCCTCAGCTGG - Intergenic