ID: 1132521617

View in Genome Browser
Species Human (GRCh38)
Location 16:392806-392828
Sequence GCTGCTGCTCCGCCACCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 537
Summary {0: 1, 1: 0, 2: 7, 3: 66, 4: 463}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132521617_1132521618 -8 Left 1132521617 16:392806-392828 CCAGGAGGTGGCGGAGCAGCAGC 0: 1
1: 0
2: 7
3: 66
4: 463
Right 1132521618 16:392821-392843 GCAGCAGCAGCTGCAGTCTTTGG 0: 1
1: 0
2: 2
3: 74
4: 577

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132521617 Original CRISPR GCTGCTGCTCCGCCACCTCC TGG (reversed) Intergenic
900513912 1:3072466-3072488 GCTGCAGCTCCCCCACCCCAGGG - Intronic
900704494 1:4071856-4071878 GCTGCTGCTGAGCCACTTCCAGG + Intergenic
901796373 1:11681640-11681662 GCCCCTGCTCCGCCCCCACCGGG + Intronic
901801056 1:11708194-11708216 GCTCCGGCTCCGCCAGCTCCAGG + Intronic
901870710 1:12137748-12137770 GCTCCAGGTCCCCCACCTCCTGG - Intronic
901881942 1:12199241-12199263 GCTGCTTCTCCTCCCCTTCCAGG + Intronic
902158845 1:14512688-14512710 GCTGCTGTTCCGACACCCACTGG + Intergenic
902330703 1:15729961-15729983 GCTGCTGCTCTGCCATCTCAGGG - Intronic
902447363 1:16475875-16475897 GCTGCTGCTCCACTGCCTCCTGG + Intergenic
902447840 1:16478391-16478413 CCTGCTGCTGGGCCACCTGCAGG + Intergenic
902467215 1:16625825-16625847 GCTGTTGCTCCAGCGCCTCCTGG + Intergenic
902467740 1:16628604-16628626 CCTGCTGCTGGGCCACCTGCAGG + Intergenic
902506840 1:16944124-16944146 CCTGCTGCTGGGCCACCTGCAGG - Exonic
902507368 1:16946919-16946941 GCTGCTGCTCCAATGCCTCCTGG - Exonic
902509520 1:16958618-16958640 CCTGCAGCTCCGCCAGCTCCCGG - Exonic
903072324 1:20732427-20732449 GCTACCGCACCGCCTCCTCCGGG + Exonic
903134439 1:21300237-21300259 CCTGCTTCTCAGCCGCCTCCTGG - Intronic
903443585 1:23406445-23406467 TCTGCTGCTTGGCCACTTCCTGG + Intronic
903557334 1:24203238-24203260 GAGGCTGCTCCCCCACCTGCTGG - Intergenic
903573423 1:24322610-24322632 CCTGCGGCTCCGCCAGCTGCTGG + Intronic
903621701 1:24702797-24702819 TCTCCTGCTCAGCCCCCTCCAGG + Intergenic
904274210 1:29369712-29369734 GCTGCTGTCCAGCCCCCTCCTGG + Intergenic
904364501 1:30001802-30001824 GCTGCTGCCCAGCCCCCTCCTGG + Intergenic
904423754 1:30410377-30410399 GCTGCTGTCCAGCCCCCTCCTGG - Intergenic
904831122 1:33307404-33307426 AGTGCTGCTCCGCCGTCTCCAGG + Exonic
905399213 1:37689805-37689827 CCTGCTGCTCCTCCACCACGGGG + Exonic
905410286 1:37763991-37764013 GCTGCTGATCCGATGCCTCCTGG - Intronic
905876079 1:41432888-41432910 GCTGCTGCAGCGCCCCCTGCTGG + Intergenic
905959651 1:42033007-42033029 GCTCCTGCTTGGACACCTCCAGG - Intronic
907275840 1:53316203-53316225 GCTGCAGCTCTCCCACTTCCTGG - Intronic
908326308 1:63027353-63027375 CCTCCTCCTCCGCCAGCTCCTGG - Intergenic
908847489 1:68339561-68339583 GCTGCTGGTCCATCTCCTCCTGG + Intergenic
909271418 1:73627757-73627779 GCTGCTTCTCTTCCAGCTCCAGG + Intergenic
911088667 1:94000730-94000752 CCTGCTGCTCCGTCATCCCCTGG - Intronic
912174473 1:107140097-107140119 GCTGCCGCTCCACGACCTCGGGG - Intronic
914779369 1:150770982-150771004 GCTGCTGCTCCTGCTCCTGCTGG - Intergenic
914912945 1:151801576-151801598 GCTCCGGCTCCGCCGCCACCTGG - Exonic
914950258 1:152107855-152107877 GCTGCTGTTCCTCCCTCTCCTGG + Exonic
914950299 1:152108167-152108189 GCTGCTGTTCCTCCCCTTCCTGG + Exonic
914950339 1:152108503-152108525 GCTGCTGTTCCTCCCTCTCCTGG + Exonic
914950651 1:152110762-152110784 GCTCCTTCTCCTCCTCCTCCGGG + Exonic
914950864 1:152112325-152112347 GCTGCTGCTGCTCTTCCTCCTGG + Exonic
915034542 1:152910952-152910974 GCTGCCCCTCCTCCTCCTCCAGG - Exonic
916729588 1:167553872-167553894 TCTGCAGCTCCGCAACCTGCAGG + Intergenic
916739704 1:167637505-167637527 GCTGCTCTTCCCCCACCTCCTGG + Intronic
916785745 1:168085866-168085888 GCTGCTGCTCCACCACCCCGGGG + Intronic
917121897 1:171652090-171652112 GCTGCTGCTTTCCAACCTCCTGG + Exonic
917486503 1:175459656-175459678 ACTGCTGCCACCCCACCTCCTGG - Intronic
918077041 1:181178392-181178414 GCTGCTCCTCCTCCACATCCTGG - Intergenic
919382711 1:196878248-196878270 GCTGCTGCTCCGGCTGCTCTTGG + Intronic
920002754 1:202810979-202811001 GCTCCGGCCCCGGCACCTCCAGG - Intergenic
920381350 1:205536312-205536334 GCTGCTGCTCTACCACCACCTGG - Intergenic
922663210 1:227447876-227447898 TTTCCTGCTCTGCCACCTCCCGG + Intergenic
923436473 1:233972005-233972027 GCTGGGGCTCCCTCACCTCCAGG - Intronic
923782943 1:237042252-237042274 GCTGCTTCCCCGCGTCCTCCGGG + Exonic
1063362658 10:5470351-5470373 GCTGCTGCTCTGTCACCTCCAGG - Intergenic
1063945358 10:11170667-11170689 ACTCCTCCTCCTCCACCTCCTGG - Intronic
1065526078 10:26622523-26622545 GCCCCTGCCCCGCCGCCTCCCGG + Intergenic
1065843876 10:29728918-29728940 GCTGTCGCCCAGCCACCTCCCGG - Intronic
1067024868 10:42836218-42836240 GCAGCTCCTCCGCCCCCTCCCGG + Intergenic
1067113676 10:43418627-43418649 GAGGTTGCTCCTCCACCTCCCGG - Intergenic
1067135675 10:43605547-43605569 GCTACTCCTCCCCCACCACCAGG - Intergenic
1067391205 10:45865502-45865524 GGGGCTGCCCCCCCACCTCCCGG + Intergenic
1067481093 10:46598052-46598074 GCGGCCCCTCCGCCACCTCGCGG - Intergenic
1067613659 10:47743770-47743792 GCGGCCCCTCCGCCACCTCGCGG + Intergenic
1067872074 10:49970609-49970631 GGGGCTGCCCCCCCACCTCCCGG - Intronic
1069651475 10:70052976-70052998 GGTGCTGCGCCGCCTGCTCCCGG - Exonic
1069664560 10:70145986-70146008 GCTCCTCCTCCACCTCCTCCTGG + Exonic
1070801460 10:79246713-79246735 GCTGCTGCTCTGCCAGGCCCTGG - Intronic
1070954514 10:80455104-80455126 GCTGCTTCTCCTCCACCCCCAGG + Intronic
1071629069 10:87203742-87203764 GCGGCCCCTCCGCCACCTCGCGG + Intergenic
1072286575 10:93921436-93921458 TTTTCAGCTCCGCCACCTCCCGG + Intronic
1073053367 10:100683863-100683885 GCAGCTGCCCCTCCAGCTCCAGG + Intergenic
1073266177 10:102229932-102229954 GGTGCTGCGGCGCCACCTCGTGG - Intergenic
1073519807 10:104117441-104117463 GCTTCTGCTCTTCCACCTCTTGG - Intergenic
1074295709 10:112186212-112186234 GATGCTGCTCCACCATCTTCTGG - Intronic
1074359064 10:112810706-112810728 GCTGATGCTACCCCAGCTCCAGG - Intronic
1074496058 10:113980951-113980973 GGAGCTGCTGGGCCACCTCCTGG + Intergenic
1074801490 10:117005200-117005222 GCTCCCGCTCCTCCTCCTCCTGG + Exonic
1075437357 10:122454857-122454879 GCTCCTTCTCCACCAACTCCAGG - Exonic
1075519429 10:123135210-123135232 GCTGCCGCTCCCCCGCCCCCTGG - Intergenic
1075545016 10:123348632-123348654 ACTGCTGCTCCACCACCTCCTGG + Intergenic
1076027201 10:127125556-127125578 TCAGCTGCTCAGCCACATCCTGG + Exonic
1076399764 10:130174318-130174340 GCTGCTGCTTCTTAACCTCCTGG - Intronic
1076447435 10:130526308-130526330 GCTTCCTCTCCGTCACCTCCTGG + Intergenic
1077488531 11:2850059-2850081 ACTGCTGCTCCCGCTCCTCCCGG - Intergenic
1079687436 11:23377466-23377488 GCTGCTCATCCTACACCTCCAGG - Intergenic
1080425116 11:32147764-32147786 ACTGGTGCTCCATCACCTCCTGG + Intergenic
1080583165 11:33659910-33659932 TCTGCTGCTCCCCCAACCCCTGG + Intronic
1080776844 11:35394307-35394329 CCTGCTGCTCAGTCACCACCGGG + Intronic
1081617819 11:44601030-44601052 GCGCCTGCTCGGCCTCCTCCAGG + Intronic
1081967926 11:47180595-47180617 GCAGCTTCTCCCGCACCTCCAGG + Exonic
1082986136 11:59172505-59172527 CCTCCTGCGCCGCCGCCTCCGGG - Exonic
1083179135 11:60972993-60973015 GCTGCTGCTCCAGAAACTCCTGG - Intronic
1083365776 11:62140755-62140777 GCTGCAGCTCCTCATCCTCCAGG - Exonic
1083675542 11:64322921-64322943 GCTGCCTCTCAGCCACCTACAGG + Intergenic
1083711684 11:64553648-64553670 GCAGCTGCTCTGCCACCTGGCGG - Intergenic
1083808625 11:65089665-65089687 CTTTCTGCTCCGCCACCTTCAGG + Intronic
1083835254 11:65262307-65262329 GCAGCTCCTCCGCCAGCTGCTGG - Exonic
1083954651 11:65976739-65976761 GCTGCTGCTTCTCCTCGTCCAGG - Exonic
1084032833 11:66491350-66491372 CCAGCTGCTCCACCACCTTCTGG - Exonic
1084169135 11:67392094-67392116 GCTGCTGCACCGCCGCTGCCAGG - Intronic
1084214830 11:67641580-67641602 ACGGCTGCCACGCCACCTCCTGG - Intergenic
1084531507 11:69730527-69730549 GCAGCTGCTCCTCCACCTGCAGG - Intergenic
1084691728 11:70731408-70731430 GCTCCTTCTCCCCCATCTCCTGG + Intronic
1084734962 11:71098952-71098974 GATGCTGCCCCCCCATCTCCTGG - Intronic
1084860269 11:72013590-72013612 GCTGTTTCTCAGCCTCCTCCCGG + Exonic
1084978352 11:72815383-72815405 GCTGCTGGTCCTCTACCTTCAGG + Intronic
1085054447 11:73395547-73395569 GCTGCAGCTCCACCTCCTCCAGG - Exonic
1085477295 11:76796504-76796526 GGCGCTGCTCCTCCACCTCCCGG + Exonic
1088496726 11:110438978-110439000 GCTGATTCACCTCCACCTCCTGG + Intronic
1088893224 11:114060222-114060244 TCTGTTGCTCCGCCAGCCCCTGG - Intronic
1089709284 11:120303241-120303263 GCTGCTCTTCCGCCTCCTCCTGG + Intronic
1090000629 11:122954204-122954226 GCTGCTGCAGCTCCAGCTCCAGG + Intronic
1090509773 11:127362923-127362945 TCTGCTGCTCCACCACCTAGAGG + Intergenic
1090645148 11:128761156-128761178 GCTGCTGCTCCTAGACCCCCAGG + Intronic
1091321832 11:134657314-134657336 GCTGCTGCTGCTCAAGCTCCGGG - Intergenic
1091372903 11:135075882-135075904 GGTGCCCCTACGCCACCTCCTGG - Intergenic
1092489510 12:8932717-8932739 GCTGCTGCTGCGCCAACTGGAGG - Exonic
1093600245 12:21012830-21012852 GCTCCTGAACCTCCACCTCCTGG - Intergenic
1096870264 12:54588401-54588423 GCACCTGCTCCGCCGCCTCGGGG + Exonic
1096946425 12:55413455-55413477 GCTGCTGCTGCGCCAACTGGAGG + Intergenic
1096983784 12:55743604-55743626 GCAGCTGCTTCACCACCTCGCGG - Exonic
1097004009 12:55901982-55902004 GCTGCAGCTCTTCCACCTGCCGG + Exonic
1098029083 12:66235586-66235608 GCTGCTCCTCCGCTGCCGCCGGG - Intronic
1098077625 12:66749809-66749831 GCTGCTGCTCTGACATCTCCGGG - Intronic
1101963183 12:109265151-109265173 GCGTCTGCGCCGCCTCCTCCTGG + Exonic
1102453298 12:113056886-113056908 GCTCCAGCACCGCCGCCTCCTGG - Intronic
1102463092 12:113112278-113112300 GCTGCTCCGCCGGCCCCTCCAGG - Exonic
1103850268 12:123928437-123928459 GCTGCAGAACTGCCACCTCCTGG + Exonic
1104005594 12:124890051-124890073 CCTGCTGCTCCACCATCCCCAGG + Intergenic
1104347028 12:128009459-128009481 GCTAATGCTCCGGCAGCTCCTGG + Intergenic
1104811737 12:131623593-131623615 GCTGCTGGTCAGTCAGCTCCTGG - Intergenic
1104835409 12:131786878-131786900 GCTGCTGCCCCTCTACCTGCTGG + Intronic
1104983446 12:132583757-132583779 GCTACCGCGCCTCCACCTCCGGG - Exonic
1105706011 13:22967782-22967804 GCTGCTGCTCCCCCTCCCACAGG + Intergenic
1105858910 13:24392766-24392788 GCTGCTGCTCCCCCTCCTGCAGG + Intergenic
1106406621 13:29480256-29480278 GCAGCCGCTCCTCCAGCTCCTGG - Exonic
1106664486 13:31837385-31837407 GCTGTTGCTCCACCATCCCCTGG + Intergenic
1107431585 13:40345324-40345346 GCTGATGCTCTCCCAGCTCCAGG + Intergenic
1107737766 13:43416647-43416669 GCCTCTGCCCCGCCACCACCCGG - Intronic
1110887218 13:80654999-80655021 GCTCCGGCCCCGCCACGTCCGGG - Intergenic
1112284814 13:98094840-98094862 GCTGCTGAGCAGCCACCACCAGG - Intergenic
1112692862 13:101916547-101916569 GGGGCTGCTCCGCCTCCTGCTGG + Intronic
1112926362 13:104679814-104679836 TCTGCAGCTCCTCCACCTGCAGG - Intergenic
1113738447 13:112694382-112694404 GCTGCTGCTCAGCTACCTGTGGG + Intronic
1113892643 13:113744385-113744407 CCTGCTGCTCCCCCCACTCCAGG + Intergenic
1114529314 14:23385969-23385991 GCTCCTGCTCCGCCAGCTTCCGG + Exonic
1114534725 14:23415670-23415692 GCTCCTGCTCCGCCAGCTTCCGG + Exonic
1114736428 14:25048729-25048751 GCTGAAGCTCCTCCACCCCCAGG + Intronic
1116827685 14:49688224-49688246 GCCGCAGCTCCGCCCCTTCCCGG + Exonic
1118928154 14:70212968-70212990 GCTGCTGCTCCTGGCCCTCCAGG - Intergenic
1120749685 14:88186251-88186273 GCATGTGCTCCGTCACCTCCTGG - Intronic
1120789167 14:88563294-88563316 GCTGCGGCTCCTCCTCGTCCAGG + Intronic
1120986148 14:90336757-90336779 TCTGCTTCTCCACCAGCTCCTGG - Intergenic
1121338573 14:93091927-93091949 GCTGCTGCTCGGCCCTCTTCAGG + Intronic
1121655882 14:95595224-95595246 GCTCCTCCTCGCCCACCTCCTGG + Intergenic
1121838710 14:97115189-97115211 GCTGCTGCTCCCCCACCATCAGG - Intergenic
1122686885 14:103512881-103512903 GCGGCTGGGCCGCCAACTCCTGG + Intergenic
1122742451 14:103880134-103880156 GCTGCTGCCCCACCCCCACCCGG + Intergenic
1122860307 14:104579539-104579561 GCTGCTGTTCCTACCCCTCCCGG - Intronic
1123023043 14:105411216-105411238 GCTGCTCCAGCGCCAGCTCCCGG - Intronic
1123493598 15:20800863-20800885 ACTCCTGCTCCGCCACGTCCTGG + Intergenic
1123550106 15:21369965-21369987 ACTCCTGCTCCGCCACGTCCTGG + Intergenic
1124053186 15:26218179-26218201 GCTGCTGCTCCTGCCCCTCAAGG - Intergenic
1124813864 15:32968852-32968874 CCTCCTGCTCCACCACCCCCAGG - Exonic
1125817844 15:42601572-42601594 GGGGCTGCCCCCCCACCTCCCGG + Intronic
1125861586 15:43005234-43005256 GAGGCTGCCCCCCCACCTCCTGG - Intronic
1126392857 15:48178114-48178136 GCTGCTTCTCCGCCTCCGCGGGG + Exonic
1127254372 15:57276725-57276747 GGTGCTGCTCCACTATCTCCTGG - Intronic
1127848140 15:62889467-62889489 GCCGCTGCACTGCGACCTCCAGG - Intergenic
1127933331 15:63612397-63612419 GATGCTGCTCATCCACCTCACGG + Exonic
1128062445 15:64743464-64743486 GCTGCTTTTCCGCTTCCTCCGGG + Intronic
1128252347 15:66172124-66172146 GATGGTCCTCCGCCTCCTCCAGG + Intronic
1128719750 15:69939753-69939775 GCTGCTGCTGCCCCAACTCCTGG - Intergenic
1128736135 15:70055012-70055034 GCTGCTGCGCCGCCTCCAGCTGG - Intronic
1129239062 15:74241059-74241081 GCTCCTCCTCCTTCACCTCCAGG + Intronic
1129260735 15:74365854-74365876 CCTGCTTCGCCGCCGCCTCCTGG + Intronic
1129727305 15:77908079-77908101 CCTCCTTCCCCGCCACCTCCCGG - Intergenic
1129878339 15:78991731-78991753 TCAGCTGCTCCGCGATCTCCAGG + Exonic
1130652397 15:85769507-85769529 GCAGCAGCTCCAGCACCTCCGGG + Exonic
1131171980 15:90185121-90185143 TCGCCTGGTCCGCCACCTCCCGG - Intronic
1132330153 15:101007101-101007123 GCTCCTCCTCCGCCCACTCCAGG - Intronic
1202958436 15_KI270727v1_random:97183-97205 ACTCCTGCTCCGCCACGTCCTGG + Intergenic
1132521617 16:392806-392828 GCTGCTGCTCCGCCACCTCCTGG - Intergenic
1132809036 16:1788864-1788886 GCTGCTGGTGCGACACATCCTGG - Exonic
1132867339 16:2100021-2100043 GCTGCAGCTCAGCCACCAGCAGG + Exonic
1132877505 16:2146925-2146947 GCTGCTGCTCAGGTACCCCCAGG - Intronic
1133209244 16:4253925-4253947 GCTGCGGCCCCGCCCCTTCCCGG - Intergenic
1133316105 16:4885057-4885079 GCTCCTGCTCCACAAGCTCCAGG + Exonic
1134524438 16:14933094-14933116 GCTGCAGCTCAGCCACCAGCAGG - Intronic
1134530110 16:14975925-14975947 GCAGCTGCTCCACAACTTCCTGG + Intronic
1134568948 16:15275038-15275060 GCAGCTGCTTCTCCAGCTCCAGG - Intergenic
1134712026 16:16331581-16331603 GCTGCAGCTCAGCCACCAGCAGG - Intergenic
1134719883 16:16374874-16374896 GCTGCAGCTCAGCCACCAGCAGG - Intergenic
1134733486 16:16481324-16481346 GCAGCTGCTTCTCCAGCTCCAGG + Intergenic
1134934016 16:18230958-18230980 GCAGCTGCTTCTCCAGCTCCAGG - Intergenic
1134947543 16:18337011-18337033 GCTGCAGCTCAGCCACCAGCAGG + Intergenic
1134954802 16:18377113-18377135 GCTGCAGCTCAGCCACCAGCAGG + Intergenic
1136002287 16:27303885-27303907 GCTCCTCCTCTGCCACTTCCTGG + Intergenic
1136294291 16:29292930-29292952 GCTGCTGCTCCAGGACCCCCTGG - Intergenic
1136573318 16:31109265-31109287 GCTTCCGCTCCGGCCCCTCCTGG + Exonic
1136576322 16:31127426-31127448 GCGGCTGCGCCGGCAGCTCCAGG + Intronic
1136933216 16:34436795-34436817 CCTGCAGCTCCCCCAACTCCAGG - Intergenic
1136971356 16:34975019-34975041 CCTGCAGCTCCCCCAACTCCAGG + Intergenic
1137783341 16:51115997-51116019 GCTGCTGCTGCTACAGCTCCAGG + Intergenic
1138387179 16:56643648-56643670 GCTCCTGTTCCGCCTCCTACCGG + Intronic
1138595317 16:58026410-58026432 GCGGCCGCGCCGCCTCCTCCCGG - Exonic
1139283366 16:65788669-65788691 GCTCCTGCTCTGCCATTTCCAGG + Intergenic
1139289436 16:65844133-65844155 GCTGCTGCACAGCCAGCTGCTGG - Intergenic
1139866237 16:70065029-70065051 GCAGCTGCTCCACAACTTCCTGG - Intergenic
1141203189 16:81913134-81913156 GCTGCTGCCCAACCACCTCTAGG + Intronic
1141252405 16:82370309-82370331 GCTGTTTCTCTGCCACCTGCAGG - Intergenic
1142007015 16:87694153-87694175 GCTGCTGCCCCTCCTCCTCCTGG - Intronic
1142183104 16:88681256-88681278 GCAGCTGCACTGCCACCTGCAGG - Exonic
1142407475 16:89898797-89898819 GCTGCTGCTCATCGACCACCTGG + Exonic
1142409848 16:89910457-89910479 GCTGCTGCTCTGCCCCCTGGCGG + Intronic
1142413143 16:89926230-89926252 GCTGCGGCACCGCCTCCTCGCGG + Intronic
1142665884 17:1463604-1463626 GTTGCTGCCACCCCACCTCCAGG + Intergenic
1142979341 17:3662725-3662747 GCTGCGGCTCCACCAGCCCCGGG + Intergenic
1143011064 17:3866417-3866439 GCTGCGGCTCAGCCGCTTCCCGG - Intronic
1146062255 17:29613528-29613550 GCTCCAGCTCCTCCTCCTCCTGG - Exonic
1146167533 17:30601215-30601237 GCTGCTGCTCCCCGAGCCCCGGG - Intergenic
1146894919 17:36534419-36534441 GCAGCTGCCCTGACACCTCCCGG + Intronic
1147742302 17:42676235-42676257 GCTGCTGCTCCGAGAGCTCCCGG + Intronic
1147907536 17:43832885-43832907 CCTGCTGCTCCGCGTCCTCCGGG - Intronic
1147981856 17:44279825-44279847 GCTGCTGCCCCGCCAGAGCCTGG - Intergenic
1148062027 17:44843129-44843151 CCTGCTGCTCCTCTTCCTCCAGG - Intergenic
1148066157 17:44871737-44871759 GCTGATGCTCCACCGCCTACTGG + Intronic
1148336130 17:46842329-46842351 GCTGCTGCTCTACAACCTCAGGG + Intronic
1148555816 17:48578021-48578043 GCTCCTGCGCCGCCACCCGCCGG - Exonic
1150293552 17:63995840-63995862 GCTGCTCCTGTGCCACCTTCTGG + Intergenic
1151438792 17:74115016-74115038 GCTGGTGCTCAGCCTCCCCCGGG + Intergenic
1151974669 17:77477638-77477660 GCTCCTGCTCTGCGAGCTCCTGG - Intronic
1151980332 17:77504605-77504627 TCTGCTTCTCCGGCCCCTCCTGG - Intergenic
1152049413 17:77960056-77960078 GCTCCTCCTCCCCTACCTCCCGG - Intergenic
1152069145 17:78126545-78126567 GCTGCAGCTCCAGCCCCTCCTGG + Exonic
1152070403 17:78131378-78131400 TCTGCCGCTCTGCCACCTCCGGG - Exonic
1152103455 17:78315843-78315865 CCTGCTCCTCCTCCTCCTCCTGG + Intergenic
1152464262 17:80456909-80456931 GCTGTTGCTCCACCAGCTCCAGG - Intergenic
1152721301 17:81925020-81925042 GCTGCCCCTCCCCCACCCCCCGG - Intronic
1152789971 17:82273584-82273606 GCCGCTGCTCCGGCCCCTACCGG + Exonic
1153343269 18:3998919-3998941 GGTGCTGTTCTGCCACCTACTGG + Intronic
1153961080 18:10140673-10140695 GCTGCAGCTCAGCTTCCTCCTGG - Intergenic
1155212995 18:23619182-23619204 GCTGGTGCTGCGCCTCCTGCAGG - Intronic
1155756039 18:29497799-29497821 GATTCTGTTCTGCCACCTCCCGG + Intergenic
1156088818 18:33440792-33440814 GCTGCTGCTCCGGGGCCTCCTGG + Intronic
1156547828 18:37983149-37983171 GCTGCTGCTTCGCAACAACCAGG - Intergenic
1157711884 18:49855872-49855894 GCTCCTGCTCCGCCACCACCTGG + Intronic
1157867115 18:51196999-51197021 GCTCCAGCTCGGCCGCCTCCGGG + Exonic
1158884690 18:61816001-61816023 GCTCCTCCTCCACCGCCTCCTGG + Exonic
1159947803 18:74457118-74457140 GCTGCTGCTCCGCGCGCACCCGG - Exonic
1160534992 18:79586945-79586967 CCTGCTGCCCCGGCACCTGCGGG + Intergenic
1160653571 19:247254-247276 GGTGCCCCTACGCCACCTCCTGG + Intergenic
1160779710 19:872397-872419 GCGGCTGCTCCTCCACGTGCAGG - Intronic
1160810001 19:1009176-1009198 GCTGCTGCTGCTCCACCTCGGGG - Exonic
1160963440 19:1734961-1734983 TCTGCTGCTCTGCCGCCTCCTGG - Intergenic
1161022096 19:2015436-2015458 GCTGCAGCGCCGCCGCCCCCGGG + Exonic
1161073246 19:2272747-2272769 GCTGCTCCTCAGCGAACTCCAGG - Exonic
1161355410 19:3816673-3816695 GCAGCTGCCCCGGCAGCTCCAGG - Exonic
1161459613 19:4389046-4389068 GCTGCTGTTGAGCCACCACCAGG + Intronic
1161564963 19:4996891-4996913 GCTGCTGCTCAGCACCCTGCAGG - Intronic
1161655261 19:5510475-5510497 GCTGCAGCTACGCCTCCTCCAGG - Intergenic
1162105183 19:8365995-8366017 GCTGCTGCTGGGCCACCTTGTGG - Exonic
1162948480 19:14057371-14057393 GTTTCTCCTCCTCCACCTCCCGG + Exonic
1163183236 19:15618542-15618564 GCTCCTGCTACGCCTCCTCCAGG - Intronic
1163595933 19:18221007-18221029 GCTGGGGCTCCGGCGCCTCCAGG - Intronic
1163666589 19:18606566-18606588 GCTGCTGCTCTGCGTCCTCGGGG - Exonic
1164520234 19:28973357-28973379 GCTTCTGCTCCCTCAGCTCCCGG - Intergenic
1164841128 19:31393203-31393225 CTTGCTGCTCGGCCAGCTCCTGG + Intergenic
1165326121 19:35115509-35115531 TCTCCTGCTCCTCCTCCTCCAGG - Intergenic
1165441181 19:35828959-35828981 GCTGATGCTCTGGCACCTCCTGG - Intronic
1165830018 19:38725822-38725844 GCTGCTGCTCCAGCAGGTCCAGG - Exonic
1165899719 19:39163387-39163409 CCTCCTGCCCCGCCCCCTCCAGG - Intronic
1165922428 19:39307483-39307505 GAGGCTGCCCCGCCCCCTCCCGG + Exonic
1166288831 19:41848809-41848831 TCTGCTGCTCAGCCATCCCCCGG + Exonic
1166299121 19:41904244-41904266 GCTGCTGCTGCTCCAGCGCCAGG + Exonic
1166317872 19:41998873-41998895 ACTCGTGCTCCGCCAGCTCCCGG + Exonic
1166694745 19:44846235-44846257 GCTCCGGCCCCGCCCCCTCCTGG - Intronic
1166812213 19:45521380-45521402 TCTGCTGCTCCACCTCCTCCGGG - Exonic
1167039325 19:47013302-47013324 CCTGCTTCTCGGCCAGCTCCTGG - Intergenic
1167233070 19:48297488-48297510 GCTGCGCCTCCGCCTGCTCCTGG + Exonic
1167509862 19:49890350-49890372 GCCGCTGCCCCGCCACATGCAGG - Exonic
1167631583 19:50629335-50629357 GGGGCTGCTCGGCCAGCTCCAGG + Exonic
925031590 2:654041-654063 GCTGCAGCCCCGGCTCCTCCTGG + Intergenic
925185203 2:1842397-1842419 GCCCCTGCTGCCCCACCTCCTGG + Intronic
925780617 2:7378509-7378531 GATGCTGTGCCGCCAGCTCCTGG + Intergenic
929159950 2:38822021-38822043 ACTCCTGCTCCACCACCCCCCGG + Intronic
932338283 2:70943448-70943470 CCTGCTGCTCGGACACCTGCAGG - Intronic
932438856 2:71719136-71719158 GCTGCTCCTCAGCCAGCTCCTGG + Intergenic
932777805 2:74538985-74539007 GCTGCTGCTGCTCCTCCTCTTGG + Intronic
934087751 2:88524681-88524703 GCTCCTGCCCTCCCACCTCCAGG - Exonic
934123718 2:88865979-88866001 GCTGCTTCTTTGCCGCCTCCAGG + Intergenic
934566905 2:95346383-95346405 ACCGCTGCTCCGCCAGCCCCTGG - Intronic
934860932 2:97763216-97763238 GCTGCTTCTCCCCTACCCCCAGG + Intronic
934954603 2:98607256-98607278 GCTGCCGTTCAGCCAGCTCCTGG - Intronic
936058643 2:109280222-109280244 GCTGCTGCTTCTCCACAGCCAGG - Intronic
937325896 2:120989424-120989446 GCTTCTGCTGCACCACCGCCAGG - Exonic
937930113 2:127197982-127198004 GCAGCGGCACCGCCCCCTCCCGG - Intronic
937941978 2:127293462-127293484 GCTGCCGCTCCGCACACTCCTGG + Intronic
938405713 2:131032093-131032115 GCTGCTTCTGCCCCACCTCATGG + Intronic
938528845 2:132162810-132162832 CCTGCTGCTCAGCCGCATCCTGG - Intronic
938566261 2:132521661-132521683 GCTGCCTCTCCTCCATCTCCGGG + Intronic
938666245 2:133540859-133540881 CTTGCTGCACCTCCACCTCCTGG - Intronic
941021004 2:160407840-160407862 GCTGCTCCTCCGCTGCCGCCGGG - Intronic
942139782 2:172966466-172966488 GCTGCTGCTGCTGCTCCTCCAGG + Intronic
942913605 2:181276032-181276054 CCTGCAGCTCCTCCAGCTCCTGG + Intergenic
943847416 2:192669692-192669714 GCTGCTGCTTGGCCAGCTCCCGG - Intergenic
944010355 2:194966921-194966943 ACTGCTGCTCAGCCACCTACAGG + Intergenic
944517404 2:200526197-200526219 GCTGCTGCTCGCCGAGCTCCCGG + Exonic
944743866 2:202636026-202636048 GCCGCTGCACCTCCACCACCAGG - Intronic
945245165 2:207711370-207711392 CCTGCTGCCCCGCCCCCGCCTGG - Intergenic
946372710 2:219290418-219290440 CCTGCTTCTGCGCCTCCTCCAGG - Intronic
946433879 2:219639683-219639705 CCCGCTGCTCCCGCACCTCCTGG - Exonic
947256879 2:228176489-228176511 GTTGCTTCTCTGCCTCCTCCTGG - Intronic
948249942 2:236519160-236519182 GCTGCTGCTCCTCCAGCCCTGGG - Intergenic
948372563 2:237498906-237498928 GCTGCTGATCGGGCAGCTCCTGG - Intronic
948412494 2:237774909-237774931 GCTGCTGTTACTCCACCTGCTGG + Intronic
948602466 2:239115244-239115266 GCTCCTCCTCCGTCTCCTCCGGG + Exonic
948686031 2:239670235-239670257 GCTCCTGCACAGCCACCTTCTGG - Intergenic
1168893427 20:1308537-1308559 GCTGCCGCACCTCCACCGCCTGG - Exonic
1168974242 20:1952311-1952333 ACTCCAGCTCCGCCACTTCCTGG + Intergenic
1170026181 20:11891324-11891346 CCTGGACCTCCGCCACCTCCGGG - Intronic
1170568889 20:17621929-17621951 GCTGCTTCTCCGATTCCTCCTGG + Exonic
1170570017 20:17627355-17627377 GCTGCTGGTCAGCCTCCGCCTGG + Exonic
1170779265 20:19409236-19409258 GCTCCTGCTGCGCCTCTTCCTGG - Intronic
1172123674 20:32612850-32612872 GCTGCTCCTCTGCCAGCTGCAGG + Intergenic
1174281110 20:49439983-49440005 GTGGCTGCTCCTCCACCTCCAGG - Intronic
1174357873 20:50010232-50010254 CCTCCTGCTCCTCCACCTGCCGG - Intergenic
1175915362 20:62423471-62423493 GCTGCAGCTCCGCCCCCTCCTGG - Intronic
1176030425 20:63008752-63008774 CCTCCTGCTCCCCCAGCTCCGGG - Intergenic
1176215514 20:63945957-63945979 GCTGCTGCTCAGTCAGCACCTGG + Exonic
1176232421 20:64039107-64039129 GCGGCGGCTCCGCCCCGTCCAGG - Intronic
1176767661 21:13037102-13037124 CCTGCTGCTCAGCCGCATCCTGG + Intergenic
1177783000 21:25639854-25639876 GCTGCTGCTGCGCTACCTGGTGG + Exonic
1178931168 21:36820353-36820375 GCTGCTGCCCAGCCACGGCCGGG + Intronic
1179262980 21:39775016-39775038 GCTGAGGCTCAGCCTCCTCCTGG + Intronic
1179499822 21:41801263-41801285 GCTGCTGCTCCGCCTGCACCTGG + Exonic
1179540242 21:42079136-42079158 GCTGCTGATCAGCCTCCCCCAGG - Intronic
1179570030 21:42273242-42273264 CCTGCTCCTCCTCCACCTCCCGG - Intronic
1179573582 21:42292459-42292481 GCACCTGCTCAGCCACCCCCAGG + Intronic
1179621337 21:42618175-42618197 ACTCCTGCTCTGCCACCCCCAGG + Intergenic
1179785700 21:43728546-43728568 GCTGATCCTCCTCCTCCTCCGGG - Intronic
1180228887 21:46414528-46414550 GCTCCTCCTCCTCCTCCTCCTGG + Intronic
1180228908 21:46414597-46414619 CCTGCTCCTCCTCCTCCTCCTGG + Intronic
1180228926 21:46414666-46414688 CCTGCTCCTCCTCCTCCTCCTGG + Intronic
1180737013 22:18024616-18024638 GCCGCAGCTCCGCGGCCTCCTGG - Intergenic
1180801506 22:18634133-18634155 TCGCCTGCTCCGCCAGCTCCGGG + Intergenic
1180831925 22:18910953-18910975 TCTGCTGGTCAGCCACCTTCCGG - Exonic
1180948182 22:19708253-19708275 CCTGCTGCTCCCCCATCTCTAGG + Intergenic
1180963411 22:19773238-19773260 CTGCCTGCTCCGCCACCTCCTGG + Intronic
1181067920 22:20315389-20315411 TCTGCTGGTCAGCCACCTTCCGG + Exonic
1181104299 22:20564463-20564485 GCTGCTGCAGCGCCACCTGCTGG - Exonic
1181309914 22:21939079-21939101 GCTGCTGCCCCGAGACCTGCTGG + Intronic
1181313363 22:21957260-21957282 GCTTCAGCTCCACCAGCTCCTGG + Exonic
1181346468 22:22223332-22223354 GCTTCAGCTCCACCAGCTCCTGG + Intergenic
1181455067 22:23054513-23054535 GCAGCAGCTCTGCCTCCTCCTGG - Intergenic
1181494244 22:23279035-23279057 GCTCCAGCTCCACCACTTCCTGG - Intronic
1182366850 22:29784793-29784815 GCTGCCTCCCCGCCACTTCCTGG + Intergenic
1183189423 22:36312222-36312244 GCTGATGCTGCGCTTCCTCCAGG - Exonic
1183879935 22:40818988-40819010 GCCGAGACTCCGCCACCTCCTGG - Intronic
1184235934 22:43183056-43183078 GCTGCTGCTTCCGCACCTCCCGG + Exonic
1185335116 22:50267903-50267925 GCTTCTTCACCGCCACCTTCTGG + Exonic
1185346730 22:50313664-50313686 CCTGCTGCGGCGGCACCTCCTGG - Exonic
1185384768 22:50526630-50526652 GCAGCGCCTCCTCCACCTCCAGG + Exonic
1203282003 22_KI270734v1_random:136224-136246 TCTGCTGGTCAGCCACCTTCCGG - Intergenic
954110208 3:48429336-48429358 GCTGCGGCTCCGCCAGACCCGGG - Exonic
954141621 3:48609705-48609727 GTTGGTGCTCGGCCGCCTCCTGG + Exonic
954145710 3:48633344-48633366 CCTTCTGCTCCAACACCTCCCGG - Exonic
954317178 3:49807495-49807517 GCTGCAGCTCCCCCAGATCCTGG + Intronic
954443581 3:50534756-50534778 GCAGCTGCTCCGGAAGCTCCTGG + Intergenic
954447554 3:50554781-50554803 CCTGCTCCTCTGCCTCCTCCAGG + Intergenic
954690198 3:52391658-52391680 GCTGCTCCTCTCCCACCCCCAGG + Intronic
955756763 3:62232919-62232941 ACTGCAGCTCTGCCACTTCCTGG + Intronic
960577532 3:119242779-119242801 GGGGCTGCCCCCCCACCTCCCGG - Intergenic
960687416 3:120307916-120307938 GCTGCTGCTGCTCCTGCTCCAGG - Intergenic
960914394 3:122681295-122681317 GCGGTTCCGCCGCCACCTCCGGG - Intronic
961402092 3:126654810-126654832 GGAGCTGCGCCGCCACCTCGTGG - Intronic
961464094 3:127071036-127071058 GCTGAGGCTCCACCACCTCAAGG - Intergenic
961639095 3:128353670-128353692 TTTGCTGCTTCGGCACCTCCCGG + Intronic
961905999 3:130263951-130263973 CCGGCTGCTCAGCCACCTCCAGG - Intergenic
962210396 3:133472452-133472474 GCTGCTGCTCCGCCTCCGCTCGG - Exonic
962279714 3:134040504-134040526 CCTGCTGATCAGCCACCTTCCGG + Intronic
962688829 3:137872851-137872873 GGGGCTGCCCCCCCACCTCCCGG - Intergenic
965690178 3:171347622-171347644 GCTGCTGCTCCGATGACTCCTGG - Intronic
966314060 3:178625355-178625377 GCGGCTGCTCCCCGACTTCCAGG - Intronic
967952794 3:194853592-194853614 GCTGGAGCTCCGCATCCTCCTGG + Intergenic
968092924 3:195909432-195909454 GCTGCTGCTCCGGCAGCGCAGGG + Intronic
968508294 4:982512-982534 GCTGCTGCTCCACCCCTGCCCGG + Intronic
968691249 4:1991583-1991605 GATTCTGCTCCTCCAGCTCCAGG + Exonic
968739850 4:2321979-2322001 GCTGCTGCGCCACTTCCTCCTGG + Intronic
969089582 4:4683680-4683702 GCTGGTCTCCCGCCACCTCCAGG - Intergenic
969344789 4:6563821-6563843 GCTCCTCCTCCGCCTCCTCCGGG + Intergenic
969413014 4:7042251-7042273 GCAGCTGCGCAGCGACCTCCTGG - Exonic
969413015 4:7042269-7042291 GCTGCTGCTCCTGCAGCTTCTGG + Exonic
969484318 4:7463495-7463517 GCTTCTGCGCCCCCACCCCCAGG - Intronic
969494708 4:7519975-7519997 GCTCCTGCTCTGCCAGTTCCAGG + Intronic
969521111 4:7678213-7678235 ACTCCTGCTCAGCCGCCTCCAGG - Intronic
969532966 4:7739857-7739879 GCTGAGGCTCCGCCCCCTCCTGG - Intronic
969612486 4:8235222-8235244 GCAGCTGCACAGTCACCTCCTGG + Intronic
969718077 4:8877947-8877969 GCTGCTCCTCCCCCAACCCCAGG + Intergenic
971294653 4:25377460-25377482 GCTGCTTCTCTCCCACCACCCGG - Exonic
972396888 4:38664910-38664932 GCTCCTGCTCCTCCCCCTCCCGG + Intronic
974047148 4:56907938-56907960 GCTGCTGCGCCGCGAGCTCGCGG - Exonic
974870575 4:67637168-67637190 GGGGCTGCCCCCCCACCTCCCGG - Intronic
978503437 4:109433473-109433495 GCTGCTGCTCCGGCCCGGCCAGG - Intergenic
979099642 4:116598994-116599016 GCTGCTGCTCCAGCAGGTCCAGG - Intergenic
979349639 4:119628896-119628918 GCTGCTGCGCCCCCCCCACCCGG + Exonic
979545229 4:121932759-121932781 GCAGCAGCTCGGTCACCTCCAGG + Exonic
985580832 5:694311-694333 GCTGCGCCTCGGCCTCCTCCAGG - Intergenic
985595454 5:785643-785665 GCTGCGCCTCGGCCTCCTCCAGG - Intergenic
985745143 5:1642620-1642642 GCTGCTGCTCCCACACCTCCAGG + Intergenic
985805183 5:2038545-2038567 GCCGCCGCACAGCCACCTCCCGG + Intergenic
989091432 5:37737514-37737536 GCTTCAGCTCCGCCACCCCCTGG + Intronic
989372304 5:40722722-40722744 GGGGCTGCCCCGCCACCTCCCGG - Intronic
989372321 5:40722765-40722787 GGGGCTGCCCCGCCACCTCCGGG - Intronic
989655876 5:43746115-43746137 GGGGCTGCCCCCCCACCTCCTGG + Intergenic
990210936 5:53480836-53480858 GCTGCTGCTCTGCCAGTTCATGG + Exonic
990345032 5:54863472-54863494 TCTGCCACTCCTCCACCTCCTGG + Intergenic
990383002 5:55233772-55233794 GCTGCAGCTCCCCCTCCCCCCGG - Intergenic
992444098 5:76819175-76819197 GCTGGGGCTCCGCATCCTCCTGG - Exonic
992507953 5:77406604-77406626 CCTCCTGCTCAGCCACCTCTGGG - Intronic
994243155 5:97447863-97447885 GCTGCTGCCCTGCCACCCTCAGG + Intergenic
997201555 5:132012768-132012790 GCTGTGGCTCAGCCAGCTCCTGG - Intergenic
997377422 5:133407100-133407122 GCTGCTCCTCACCCACCTCAGGG + Intronic
997585527 5:135040845-135040867 GCTGCCGCGCTGCCATCTCCCGG - Intronic
998131764 5:139655037-139655059 GCCGCTGCCACGGCACCTCCTGG - Intronic
998256777 5:140594349-140594371 GCTCCTGCTCTGCCTCCTGCAGG + Intergenic
998368405 5:141645818-141645840 GCTCCTGCTCCACCTCATCCTGG + Exonic
999172811 5:149609642-149609664 GCTGCAGCTCCGGCTCCTTCCGG - Exonic
999768173 5:154756052-154756074 GCAGCTCCTCCGCCAGCGCCTGG - Intronic
1001454271 5:171848675-171848697 GCTGCTCCTCCCCCACATGCAGG - Intergenic
1002029302 5:176416297-176416319 GGTCCTCCTCCGCCGCCTCCGGG + Exonic
1002029389 5:176416613-176416635 GCCGCTGCTCGGCGACCTCCCGG - Intergenic
1002303757 5:178271873-178271895 TCTGCTCCTCCACCACCTACAGG - Intronic
1002399669 5:178984603-178984625 GCTCCTGCTCCCCCACCCTCAGG - Intronic
1002711859 5:181199952-181199974 TCTGCTTCTGTGCCACCTCCCGG + Exonic
1002992262 6:2248902-2248924 GCTGCATCTCAGCCAACTCCAGG + Intergenic
1003624157 6:7727276-7727298 GCTGCTGCTCCTCCTGCTGCCGG - Exonic
1003854687 6:10261162-10261184 GCTGCTGCTCTGGCACATCCAGG - Intergenic
1004225855 6:13783664-13783686 CTTCTTGCTCCGCCACCTCCAGG - Intergenic
1005966600 6:30731016-30731038 GCTCCTGCACTGCCACCTGCTGG + Exonic
1006118034 6:31785648-31785670 GCTTCTTCTCCACCACCACCTGG + Exonic
1006217767 6:32459941-32459963 GCTCCAGCTCCGCCACCGCCCGG + Intergenic
1006977398 6:38115903-38115925 GCTGCTGCTGCACCACCCCATGG + Intronic
1007414794 6:41684982-41685004 GCTCCTGCTTCACCACCTGCTGG + Exonic
1007469847 6:42082411-42082433 ACTGCAACTCCTCCACCTCCCGG + Exonic
1007902210 6:45422663-45422685 GCTGTTGCGCAGCCACCACCGGG - Exonic
1008000889 6:46358484-46358506 GCTGATGTTCCCCCTCCTCCTGG - Intronic
1015732276 6:136361067-136361089 GCAGCTGCTCCTCCTTCTCCCGG + Exonic
1016427406 6:143949206-143949228 CCTGCTGGTAGGCCACCTCCAGG + Intronic
1017046280 6:150349900-150349922 GCAGCTGCTCTGCACCCTCCTGG + Intergenic
1018394700 6:163369315-163369337 GCTGCTGCTTCTCCAGCTCCTGG - Intergenic
1019267114 7:124156-124178 GATCCTTCTCCCCCACCTCCTGG + Intergenic
1020030317 7:4928119-4928141 GCTGCTGCTTGGCAACGTCCAGG - Intronic
1022348842 7:29546795-29546817 CCTGCTGCACAGCCTCCTCCTGG - Intergenic
1022810925 7:33868300-33868322 GCTGCTGCTGTTTCACCTCCAGG + Intergenic
1023996802 7:45163526-45163548 GCTGCTGCTCCACGACCCTCTGG - Intronic
1024582761 7:50813299-50813321 GCTTCTGCTCTGCTCCCTCCAGG + Intergenic
1024627417 7:51219909-51219931 GCTCGTGCTCCCCCACCTCCTGG - Exonic
1026704260 7:72676563-72676585 GCTGCTGCTCTTCCAGCACCTGG - Intronic
1026859763 7:73778193-73778215 GCTCCTGCTCAGCCTCCTACAGG - Intergenic
1029703770 7:102264735-102264757 GCTGCTTCTCAGCCACCACGTGG + Intronic
1030121451 7:106113778-106113800 GCTGCAACCCCCCCACCTCCCGG - Intergenic
1031513589 7:122676677-122676699 TCAGCTGCTCAGCCACATCCTGG + Intronic
1032085112 7:128879759-128879781 CCAGCAGCACCGCCACCTCCTGG + Exonic
1032903941 7:136342857-136342879 CCTGTTGCTCTGCCATCTCCTGG - Intergenic
1034671512 7:152862306-152862328 ACTGCTGCCCCTCCACCTCGTGG - Intergenic
1034998141 7:155591372-155591394 GCTGCTTCTGAGCCACCTCCAGG + Intergenic
1035048536 7:155984640-155984662 TCTGCAGCTCCCCTACCTCCTGG + Intergenic
1035211242 7:157329837-157329859 GGTGCTGCGTCTCCACCTCCGGG - Intergenic
1035388785 7:158491295-158491317 GCTGCACCTAGGCCACCTCCTGG - Intronic
1035449224 7:158964934-158964956 GTGGCTGCTCCTCCAGCTCCTGG + Intergenic
1035513102 8:207049-207071 GGTGCCCCTACGCCACCTCCTGG + Intergenic
1035722844 8:1805162-1805184 GCTGCTGCTCCTGCTTCTCCAGG + Intergenic
1036223048 8:6936911-6936933 GCTCCTGCTCTCCCTCCTCCAGG - Exonic
1036228283 8:6978646-6978668 GCTCCTGCTCTCCCTCCTCCAGG - Exonic
1036229581 8:6988286-6988308 GCTCCTGCTCTCCCTCCTCCAGG - Intergenic
1036230736 8:6997763-6997785 GCTCCTGCTCTCCCTCCTCCAGG - Exonic
1036232032 8:7007389-7007411 GCTCCTGCTCTCCCTCCTCCAGG - Intronic
1036233182 8:7016862-7016884 GCTCCTGCTCTCCCTCCTCCAGG - Exonic
1037608513 8:20457380-20457402 CCTGCTGCCCAGCCAACTCCTGG + Intergenic
1041047123 8:53898122-53898144 GCTGCTGCTCTGCCTCCCCCTGG + Intronic
1041932152 8:63298662-63298684 GCTCCAGCGCCACCACCTCCTGG - Intergenic
1044320096 8:90791790-90791812 GCTGCTGCTTCGCCGCCGCCGGG - Exonic
1044629192 8:94262398-94262420 GCTGCAGAGCCGCCCCCTCCCGG - Intergenic
1045015598 8:97999001-97999023 GCTCCTCCTCCTCCATCTCCTGG + Intronic
1046644170 8:116766744-116766766 GCAGCTGCCCCGCTACCTCATGG + Exonic
1047824742 8:128561071-128561093 TCTTCAGCTCTGCCACCTCCAGG + Intergenic
1048951940 8:139503742-139503764 GCTGCTCCTGAGCCACCACCAGG - Intergenic
1049053673 8:140218582-140218604 TCTGCTGCTCTGCTACCTGCTGG + Intronic
1049197857 8:141325387-141325409 GCTGCTGCTACGCGACCCCCCGG + Intergenic
1049460787 8:142726804-142726826 GCTTCTGCTCCAGGACCTCCAGG - Intergenic
1049552674 8:143267655-143267677 GCTGCTGCTCCGCGACCCCCAGG - Intronic
1049595879 8:143483143-143483165 GCTGCGGCGCCGCCTCCCCCCGG - Intronic
1049998464 9:1052069-1052091 GCTGCCGCTCCACCACCAGCAGG - Exonic
1050415992 9:5418517-5418539 GCTCCTCCTCCGCCACCCCCTGG + Intronic
1052840666 9:33289250-33289272 GCAGGTGCTCCCCCACTTCCAGG + Intergenic
1053066449 9:35072447-35072469 GCCGCTGCTCGCCCACCGCCTGG - Exonic
1053391851 9:37741548-37741570 GCTGCAGCTCTCCCAGCTCCTGG - Intronic
1054782029 9:69174297-69174319 GCTCCTGCTCCTACTCCTCCTGG - Intronic
1055187771 9:73475789-73475811 CCAGCTGCTCCACCACCTTCTGG + Intergenic
1055513148 9:77014759-77014781 GCTCCAGCTTCGCCACCTACTGG - Intergenic
1056532582 9:87499314-87499336 GCTGCCTCTCCTCCACCCCCAGG - Intronic
1056579908 9:87883175-87883197 CCTGCTGCTCCTCTTCCTCCCGG - Exonic
1057022948 9:91714657-91714679 GCTACGGCTCCGCCTCCTCCTGG - Intronic
1057210103 9:93196389-93196411 GATGTTGCTGAGCCACCTCCAGG - Intronic
1057354586 9:94323057-94323079 GCTCCTGCTCCTCAAGCTCCAGG - Intronic
1057653171 9:96934578-96934600 GCTCCTGCTCCTCAAGCTCCAGG + Intronic
1058885780 9:109320500-109320522 GCTGCCGCTGCGCCGCCGCCCGG + Exonic
1060059681 9:120448027-120448049 GCAGCTGCGTCACCACCTCCTGG + Exonic
1060113712 9:120925014-120925036 ACCTCTGCTCCTCCACCTCCTGG + Intronic
1060530934 9:124346684-124346706 GCTGCTGCGCCACCGCCTCAGGG + Intronic
1060794270 9:126503876-126503898 GGTGCTGCTCCCCGACTTCCAGG - Exonic
1060838745 9:126777920-126777942 GCTGCAGCAGCACCACCTCCAGG + Intergenic
1061208966 9:129179675-129179697 GCTGCTTCACCGCCTCCTCAGGG + Intergenic
1061837768 9:133340830-133340852 GCTGCTGCTCGGACAACTGCTGG + Exonic
1061927507 9:133813135-133813157 GCTCCTGCCCCTCCACCCCCAGG - Intronic
1062195347 9:135270390-135270412 TCTCCTGCCCCGCCACCTCCTGG + Intergenic
1062355167 9:136158439-136158461 GATGCTGAGCAGCCACCTCCAGG - Intergenic
1062442676 9:136578189-136578211 GCTGCTGGCCTGGCACCTCCCGG + Intergenic
1062450709 9:136614623-136614645 CCTGCTGCCCCCCAACCTCCAGG + Intergenic
1203773152 EBV:59503-59525 GCTCCTTCTCCTCCTCCTCCCGG + Intergenic
1190176914 X:48158024-48158046 GCCACTGCTCTGCCCCCTCCAGG - Intergenic
1190248093 X:48704034-48704056 GCTGCTGCTCTGCCCCCTCCTGG - Intronic
1190505042 X:51119163-51119185 GCAGATGCGCCCCCACCTCCCGG + Intergenic
1190552141 X:51595312-51595334 AATGCTGCTCCACCACCTTCTGG + Intergenic
1191226955 X:58054059-58054081 GCTGCTGCCCCACCCCCACCTGG + Intergenic
1195111626 X:101656630-101656652 GCTGCTGCAGCCCCATCTCCAGG + Exonic
1196730641 X:118938169-118938191 GCCCATGCTCCCCCACCTCCTGG + Intergenic
1197455717 X:126674115-126674137 GGGGCTGCCCCCCCACCTCCCGG - Intergenic
1198312346 X:135435140-135435162 GCTGCTGCTCCAGCGCCTCCTGG - Intergenic
1198312604 X:135436538-135436560 CCTGCAGCTCCGCCAACTCGCGG - Intergenic
1198429698 X:136553237-136553259 GATCCTGCTCCCCCACTTCCTGG + Intronic
1198600773 X:138282718-138282740 GGGGCTGCCCCCCCACCTCCTGG + Intergenic
1200124256 X:153805831-153805853 CCTGCTGCTCTGAAACCTCCTGG - Intronic
1200161880 X:154013789-154013811 GCTGCTGCCGCGCCCCCTGCTGG - Intronic