ID: 1132524747

View in Genome Browser
Species Human (GRCh38)
Location 16:408386-408408
Sequence CGGCCTGACTCCGCTTCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 86}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132524735_1132524747 29 Left 1132524735 16:408334-408356 CCTCTGTCTCCAGGCCTTTGTGT 0: 1
1: 0
2: 6
3: 63
4: 488
Right 1132524747 16:408386-408408 CGGCCTGACTCCGCTTCTCTGGG 0: 1
1: 0
2: 0
3: 6
4: 86
1132524734_1132524747 30 Left 1132524734 16:408333-408355 CCCTCTGTCTCCAGGCCTTTGTG 0: 1
1: 0
2: 2
3: 51
4: 473
Right 1132524747 16:408386-408408 CGGCCTGACTCCGCTTCTCTGGG 0: 1
1: 0
2: 0
3: 6
4: 86
1132524740_1132524747 5 Left 1132524740 16:408358-408380 CCGCCTTCTGTCTCTGGCCCTCT 0: 1
1: 0
2: 16
3: 129
4: 1274
Right 1132524747 16:408386-408408 CGGCCTGACTCCGCTTCTCTGGG 0: 1
1: 0
2: 0
3: 6
4: 86
1132524736_1132524747 20 Left 1132524736 16:408343-408365 CCAGGCCTTTGTGTCCCGCCTTC 0: 1
1: 0
2: 1
3: 9
4: 202
Right 1132524747 16:408386-408408 CGGCCTGACTCCGCTTCTCTGGG 0: 1
1: 0
2: 0
3: 6
4: 86
1132524741_1132524747 2 Left 1132524741 16:408361-408383 CCTTCTGTCTCTGGCCCTCTGTC 0: 2
1: 0
2: 58
3: 304
4: 1521
Right 1132524747 16:408386-408408 CGGCCTGACTCCGCTTCTCTGGG 0: 1
1: 0
2: 0
3: 6
4: 86
1132524739_1132524747 6 Left 1132524739 16:408357-408379 CCCGCCTTCTGTCTCTGGCCCTC 0: 1
1: 2
2: 4
3: 86
4: 704
Right 1132524747 16:408386-408408 CGGCCTGACTCCGCTTCTCTGGG 0: 1
1: 0
2: 0
3: 6
4: 86
1132524737_1132524747 15 Left 1132524737 16:408348-408370 CCTTTGTGTCCCGCCTTCTGTCT 0: 1
1: 0
2: 0
3: 23
4: 305
Right 1132524747 16:408386-408408 CGGCCTGACTCCGCTTCTCTGGG 0: 1
1: 0
2: 0
3: 6
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132524747 Original CRISPR CGGCCTGACTCCGCTTCTCT GGG Intronic
900314398 1:2049932-2049954 CGTCCGGACTCGGGTTCTCTGGG - Intergenic
900477486 1:2882732-2882754 CAGCCTGACCCTCCTTCTCTGGG + Intergenic
901049853 1:6420597-6420619 AGGGCTGCCTCTGCTTCTCTAGG - Intronic
901938479 1:12644392-12644414 TGGCCTGACACAGCTTCTCAGGG - Intergenic
905881403 1:41466532-41466554 GTGCCTGCCTCCTCTTCTCTGGG + Intergenic
906648249 1:47491627-47491649 AGGCCTGAGTCAGCTCCTCTGGG - Intergenic
906769645 1:48472301-48472323 CTGCCCGACTCCGCCTCGCTCGG - Intergenic
907311001 1:53538958-53538980 GGGGCTGAGTCAGCTTCTCTTGG + Intronic
910337807 1:86154831-86154853 GGGCCTCACTCCGCCTCTCCTGG + Intronic
916686447 1:167151648-167151670 GGGCCTGACTCTCCTACTCTAGG - Intergenic
917178480 1:172265713-172265735 TGGCCTCACTGTGCTTCTCTCGG + Intronic
921768546 1:219005112-219005134 CTCCCTGTCTCCCCTTCTCTTGG + Intergenic
1067057478 10:43060702-43060724 CTGCCCCACTCTGCTTCTCTAGG - Intergenic
1074164251 10:110860854-110860876 CTCCCTGAGTCTGCTTCTCTGGG - Intergenic
1077021657 11:419752-419774 CGGTCTGACTCAGCGTCCCTCGG + Intronic
1081692417 11:45087407-45087429 TGGCCAGTCTCTGCTTCTCTGGG - Intergenic
1083766064 11:64842210-64842232 CGGCCTGACTCTGCTTGGCCAGG + Intronic
1085284187 11:75349564-75349586 CGGAGTGACTCAGCCTCTCTTGG - Intronic
1085724578 11:78942950-78942972 CGGCCTGACAGGGCTTCTCTTGG - Intronic
1089572158 11:119418116-119418138 CTGCCTGCCCCCGCTTCGCTGGG - Exonic
1091237578 11:134032452-134032474 CTGCCTGGCTCAGCTCCTCTCGG - Intergenic
1098261398 12:68675602-68675624 GGGGCTGTCTCCTCTTCTCTAGG + Intergenic
1100830077 12:98509568-98509590 AGACCTGTCTCCGATTCTCTTGG + Intergenic
1100982144 12:100170389-100170411 GGGGCTGAGTCCGCTTCTGTGGG - Intergenic
1108446065 13:50510252-50510274 CAGCCTGTCTCTGCTTCTCATGG + Intronic
1113806202 13:113111005-113111027 CGGGGTGACTCCGCTTTCCTGGG + Intronic
1121645543 14:95515492-95515514 GGGCCTGTTTCTGCTTCTCTTGG + Intergenic
1122246122 14:100404709-100404731 TGACCTGACTCTGTTTCTCTAGG + Intronic
1123141982 14:106088645-106088667 AGCCCTGACTCCGCAGCTCTGGG - Intergenic
1123200449 14:106658250-106658272 AGCCCTGACTCCGCAGCTCTGGG - Intergenic
1124952941 15:34340258-34340280 CGGCCAGACTTTGCTTTTCTTGG - Intergenic
1127414926 15:58749187-58749209 TGCCCCGACTTCGCTTCTCTGGG + Intronic
1132149331 15:99448178-99448200 CTCCCTGCCTCTGCTTCTCTAGG - Intergenic
1132524747 16:408386-408408 CGGCCTGACTCCGCTTCTCTGGG + Intronic
1134069036 16:11249491-11249513 CGGCCACACTCGGCTTCCCTCGG - Intergenic
1135188235 16:20333340-20333362 CTGGCTGCCTCTGCTTCTCTCGG - Exonic
1135290521 16:21233830-21233852 CGGCATGACTCCTACTCTCTTGG + Exonic
1137727224 16:50665146-50665168 GGGCCTAACTGCGCCTCTCTCGG - Intergenic
1137729822 16:50681126-50681148 TGGCCTGAGTCCCCTTCTCCTGG - Intronic
1139402991 16:66696794-66696816 CGGCCTGGCTCCGCCTCTCCCGG - Intergenic
1141998100 16:87647830-87647852 AGGCCTGACACCTCCTCTCTTGG - Intronic
1142572646 17:885042-885064 AGGCCTGACTCAGCTCCGCTTGG - Intronic
1150004262 17:61460116-61460138 CTGCCTAACTTCCCTTCTCTGGG - Intronic
1151791159 17:76306970-76306992 CATCCTGACTCCCCTTCTCTGGG + Intronic
1152084840 17:78211672-78211694 CAGCCTCACTCTGCTTCTCAGGG + Intergenic
1152844948 17:82593919-82593941 TGGCCTGATCCCGCTGCTCTGGG - Intronic
1152845671 17:82598336-82598358 CCGCCTGCCTCAGCCTCTCTTGG + Intronic
1153211145 18:2766288-2766310 CGGCCTGTCTCCAGTTTTCTTGG + Intronic
1160549021 18:79681225-79681247 CGTCCTGGCTCCGCTTCCTTTGG + Intronic
1161531474 19:4792496-4792518 CGGCATGACCCCGCTGCTCGCGG + Exonic
1161838005 19:6660880-6660902 CTGTCTGACTCTGTTTCTCTGGG - Intergenic
1164540053 19:29115458-29115480 CGGCCTCACTCCACTGCCCTGGG - Intergenic
1167108271 19:47443774-47443796 CTGCCTCTCTCAGCTTCTCTGGG + Intronic
1168154114 19:54463706-54463728 GAGCCTGACACCGCTGCTCTGGG + Exonic
934714592 2:96536512-96536534 GGTCCTGCCTCCGCTCCTCTAGG + Intergenic
935737453 2:106117736-106117758 CAGCCTGACTCCGTTGCTTTAGG - Intronic
936082910 2:109446941-109446963 CTGTCTGACTCCCCTTCTCTCGG - Intronic
942283944 2:174395435-174395457 AGGACAGCCTCCGCTTCTCTAGG - Intronic
946046716 2:216827453-216827475 TGGCCTGACTCACCTCCTCTTGG + Intergenic
947431006 2:230027628-230027650 CGGCCTGCCTCGGCTTCCCAGGG + Intergenic
1169889194 20:10434256-10434278 CGCCCCCACTCCGCTTCTCCGGG + Intergenic
1174093806 20:48071214-48071236 GGGACTGACTCTGCTTCTTTGGG + Intergenic
1175003504 20:55656345-55656367 CAGCCTGAGTCTGCTTCTTTTGG - Intergenic
1181491932 22:23265570-23265592 CGGGCTGACTTCCCTGCTCTGGG + Intronic
1181516292 22:23415441-23415463 TGGCCTGACCCCGCTTCACTTGG - Intergenic
1182450658 22:30418647-30418669 TGGCCTGCCTCTGCTCCTCTTGG - Intronic
950866846 3:16196439-16196461 GGGCCTGACTCTGCTGCTTTTGG - Intronic
952321784 3:32284427-32284449 CAGCCCCACTCCGCTTCCCTGGG - Intronic
956061919 3:65356779-65356801 TGCCCTCCCTCCGCTTCTCTGGG + Exonic
961321338 3:126078467-126078489 AGGCCCCACTCTGCTTCTCTGGG + Intronic
961625141 3:128256593-128256615 GGGCCTGACTCCACTTCTTCAGG + Intronic
968506054 4:972006-972028 CTGCCTGTCCCCCCTTCTCTCGG - Intronic
968834275 4:2951563-2951585 CGTCCTGGCTCCTATTCTCTCGG - Intronic
969429712 4:7146959-7146981 CTGCCTGTCTCGGCTTCTCATGG + Intergenic
973656521 4:53053728-53053750 GGGAATGGCTCCGCTTCTCTGGG + Intronic
976486383 4:85610198-85610220 CCGCCTGCCTCCGCTTCCCAAGG - Intronic
990008519 5:50968992-50969014 CAGCCTGACTCCGGATCTCTTGG - Intergenic
1003551678 6:7107210-7107232 TGGCCTGACGCCGCCCCTCTGGG - Intergenic
1010938819 6:81891980-81892002 TGGCCTGACTCCGAGTCTTTAGG + Intergenic
1013072390 6:106740951-106740973 TGGCCTGCCTCCACTCCTCTGGG - Intergenic
1015786055 6:136922349-136922371 CGCCCTCACTCCGCTGCTCCCGG + Exonic
1026896381 7:74012324-74012346 GGGCCTGTCTCTGCGTCTCTGGG + Intergenic
1027028840 7:74874048-74874070 CGGCCTGCCTCAGCTTCCCAAGG - Intergenic
1036130111 8:6102166-6102188 CCGCCTGAGTCCCCTTCCCTGGG - Intergenic
1038602597 8:28961663-28961685 CAGCCTGATTCCACTTCTTTTGG + Intronic
1039880827 8:41624533-41624555 TGGCCAGACTCGGCTTCTCCAGG + Exonic
1053543511 9:38998834-38998856 AGGCCTGCCTCCCGTTCTCTGGG - Intergenic
1056143460 9:83707266-83707288 CGGGCTGATGCCGCTTTTCTCGG - Intronic
1057708093 9:97412199-97412221 CGGCCCGTCCCCGCGTCTCTGGG - Exonic
1058918295 9:109588552-109588574 AGGCCTAACTCCACTTCTCATGG - Intergenic
1060151927 9:121294378-121294400 CAGTCTGTCTCCCCTTCTCTCGG - Intronic
1187876443 X:23807859-23807881 CCGCCTGCCTCGGCTTCTCAAGG - Intergenic
1195078311 X:101348353-101348375 AAGGGTGACTCCGCTTCTCTGGG - Intronic