ID: 1132534518

View in Genome Browser
Species Human (GRCh38)
Location 16:471453-471475
Sequence CAGCTCGTGCCTCCTGCCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 269}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132534515_1132534518 -10 Left 1132534515 16:471440-471462 CCTTTATGCCCTACAGCTCGTGC 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1132534518 16:471453-471475 CAGCTCGTGCCTCCTGCCTCCGG 0: 1
1: 0
2: 0
3: 31
4: 269
1132534513_1132534518 -1 Left 1132534513 16:471431-471453 CCACCTCTTCCTTTATGCCCTAC 0: 1
1: 0
2: 1
3: 34
4: 370
Right 1132534518 16:471453-471475 CAGCTCGTGCCTCCTGCCTCCGG 0: 1
1: 0
2: 0
3: 31
4: 269
1132534510_1132534518 26 Left 1132534510 16:471404-471426 CCCAGGAGCTTGGGGGAAGTCTG 0: 1
1: 0
2: 0
3: 32
4: 445
Right 1132534518 16:471453-471475 CAGCTCGTGCCTCCTGCCTCCGG 0: 1
1: 0
2: 0
3: 31
4: 269
1132534511_1132534518 25 Left 1132534511 16:471405-471427 CCAGGAGCTTGGGGGAAGTCTGG 0: 1
1: 0
2: 2
3: 38
4: 605
Right 1132534518 16:471453-471475 CAGCTCGTGCCTCCTGCCTCCGG 0: 1
1: 0
2: 0
3: 31
4: 269
1132534514_1132534518 -4 Left 1132534514 16:471434-471456 CCTCTTCCTTTATGCCCTACAGC 0: 1
1: 0
2: 0
3: 14
4: 212
Right 1132534518 16:471453-471475 CAGCTCGTGCCTCCTGCCTCCGG 0: 1
1: 0
2: 0
3: 31
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132534518 Original CRISPR CAGCTCGTGCCTCCTGCCTC CGG Intronic
900183391 1:1322205-1322227 CAGCCCGGGCCCCATGCCTCGGG - Intronic
900412672 1:2520026-2520048 CCGCGCGTGCCTCCTGCCATGGG - Intronic
900505251 1:3027166-3027188 CAGCTCCTGCCTCTTGTCCCGGG + Intergenic
900524091 1:3120034-3120056 CTGCTGGTGCCTCCTTGCTCAGG + Intronic
900683280 1:3930897-3930919 CAGCCTCTCCCTCCTGCCTCAGG + Intergenic
900831972 1:4971904-4971926 CAGTTCATGCCTGCTGCCCCAGG - Intergenic
901508134 1:9699564-9699586 AGGCACCTGCCTCCTGCCTCAGG + Intronic
902688551 1:18095240-18095262 CAGCTGGGGCCTCCTGACCCAGG + Intergenic
902716631 1:18277208-18277230 CAGCTCCTGCCTCTTGTCTCAGG + Intronic
903049221 1:20588660-20588682 TTGTTCATGCCTCCTGCCTCGGG + Intergenic
903305156 1:22408164-22408186 CAGCCCAAGCCTCCTGCCACCGG + Intergenic
904132764 1:28287557-28287579 CAGCTGTTGCCTCTAGCCTCAGG - Intergenic
904610120 1:31721195-31721217 CAGCTCCCTCCTCCTTCCTCAGG - Intergenic
905683989 1:39895940-39895962 CAGCAGGTGCCTGCTGGCTCTGG - Exonic
906120820 1:43389517-43389539 CAGGTGCTGCCTCCTCCCTCCGG + Intronic
910037279 1:82803567-82803589 CCGCTCTTCCCTTCTGCCTCTGG - Intergenic
910776626 1:90883037-90883059 CAGCTCTTGGCTCTTCCCTCTGG - Intergenic
912610996 1:111043941-111043963 CAGCTCTTGCCTTTTGTCTCTGG + Intergenic
914846877 1:151288371-151288393 CAGCTCGGCCCCCCTGCCCCTGG + Exonic
915335701 1:155139991-155140013 CGGCTCGGGCCTCCTGTATCTGG + Exonic
915872584 1:159576762-159576784 CAGCTTGTGCCTCCCTCCTTTGG - Intergenic
917132161 1:171754497-171754519 CAGCTGGTGCCTCCTAGGTCTGG + Intergenic
921821158 1:219618974-219618996 CATGTCTTGCCTCCTGCCACAGG + Intergenic
922764187 1:228149088-228149110 CGGCTCGTGGCTGCTGCCCCAGG + Intergenic
923097510 1:230787391-230787413 CAGCTTGTGCACACTGCCTCAGG + Intronic
923517367 1:234709073-234709095 CAGGTCTTTCCTCTTGCCTCAGG - Intergenic
924632604 1:245754908-245754930 CACCTGGTTCCTCCTTCCTCTGG - Intronic
1063976633 10:11423041-11423063 ATTCTCGTGCCTCCAGCCTCTGG + Intergenic
1065595096 10:27302786-27302808 CAGCTCCTCCCTCATACCTCTGG - Intergenic
1068039660 10:51807893-51807915 CTTCTCCTGCCTCCTGTCTCTGG - Intronic
1068530513 10:58180733-58180755 CAGCCGGTGCCTCATGACTCAGG - Intergenic
1071078709 10:81784316-81784338 CAGCTGGTGCCACCAGCCCCGGG + Intergenic
1072787717 10:98295532-98295554 CAACTCCCTCCTCCTGCCTCTGG - Intergenic
1073267520 10:102236769-102236791 CAGGTTATGCCTCCAGCCTCAGG - Intronic
1075044968 10:119139605-119139627 CATCTCCTGCCTACTCCCTCCGG - Intergenic
1076822226 10:132945227-132945249 CACCACGTCCCTCCTGCCCCCGG - Intergenic
1076882717 10:133247455-133247477 CAGCACCTGCCTCCTGACTTGGG - Intergenic
1077077083 11:706732-706754 CAGGAAGTGCCTCCTGGCTCCGG - Exonic
1078858860 11:15228906-15228928 CAGCCCGTGCCACCTTCCTGTGG - Intronic
1080643347 11:34171025-34171047 CTGCTCGGGCATCCAGCCTCCGG + Exonic
1083577973 11:63806134-63806156 CAGCTTGGGCCTCCAGCCTAGGG + Intergenic
1083854026 11:65383308-65383330 GACCTCCTACCTCCTGCCTCTGG + Intronic
1084970401 11:72768371-72768393 GAGCACCTGCCTCTTGCCTCTGG + Intronic
1085267102 11:75243410-75243432 TAGGTCTTTCCTCCTGCCTCAGG + Exonic
1086119992 11:83295658-83295680 CAGCTCCTGACTCCTACCTCAGG + Intergenic
1087014284 11:93541379-93541401 GAGCTGGTTCCTCTTGCCTCTGG - Intronic
1087216617 11:95502033-95502055 CAGCTCATCCCACCTGCCCCAGG + Intergenic
1088910004 11:114183578-114183600 CAGCTGGTGCTTCCCTCCTCGGG + Intronic
1089048882 11:115528563-115528585 CAGCTGGTCCCTCCAGGCTCAGG - Intergenic
1089340059 11:117751053-117751075 CAGCCCCTGCCCTCTGCCTCTGG - Intronic
1089582183 11:119488497-119488519 GAGCTCGGGCCCCCTGACTCAGG + Intergenic
1090259083 11:125305844-125305866 GAGCTTGTGTCTCCTGCCTCCGG - Intronic
1090808921 11:130220082-130220104 CAGCCCGTACCCTCTGCCTCTGG - Intergenic
1090885119 11:130869002-130869024 CAGCTAGTGCCTCCATCCTCGGG - Intergenic
1091681712 12:2532272-2532294 GAGCTCTTGCCTCTTGCCTCTGG + Intronic
1094129579 12:27060862-27060884 CTGCTGGTGTCTGCTGCCTCTGG - Intronic
1094151553 12:27290002-27290024 CTGCTCATCCCTCCTGCCTTGGG - Intronic
1095972194 12:47909960-47909982 CAGCTCATGTCTTCTTCCTCGGG + Intronic
1096210854 12:49764501-49764523 TAGCTGCTGCCTCCAGCCTCTGG + Exonic
1096273468 12:50185429-50185451 CAGCTTCTGCCTCCTGCTCCTGG - Intronic
1098329655 12:69339858-69339880 CTGTTCGTGCCTCTTGCCTCTGG + Intergenic
1099897166 12:88662657-88662679 CAGCTCCTGGCTCCAGCCACTGG - Intergenic
1101725653 12:107386092-107386114 CAGCTGTTCTCTCCTGCCTCAGG + Intronic
1101946835 12:109143796-109143818 GTGCTGGTGCCTGCTGCCTCTGG + Intronic
1102029040 12:109729470-109729492 CAGGCCCTGCCTCCTGCCTCTGG - Intronic
1103042997 12:117711371-117711393 CTGCAAGTGCTTCCTGCCTCAGG - Intronic
1103700394 12:122846173-122846195 CAGCCCCTGCCTCCTGCCCTGGG + Intronic
1103737140 12:123067836-123067858 CAGCTAGTGTCTCCTGCTCCGGG + Intronic
1103797015 12:123510172-123510194 CAGCTCTGCTCTCCTGCCTCCGG + Intronic
1103907945 12:124336908-124336930 CCCCTAGTGCCTCCTGTCTCTGG - Exonic
1103956121 12:124577856-124577878 GAGCTCGTGCATCCTACCTGAGG - Intergenic
1104589784 12:130075027-130075049 CCGCAGGTGCCTCCCGCCTCGGG - Intergenic
1105503333 13:20990529-20990551 CAACTCCTGCCTCCATCCTCTGG + Intronic
1105512460 13:21061684-21061706 CCGGCCGTGCTTCCTGCCTCCGG + Intergenic
1110005279 13:70258065-70258087 CTTCTCCTGCCTCCAGCCTCTGG - Intergenic
1111348363 13:86994209-86994231 CATCTCCTGCCTCCTGCCACTGG - Intergenic
1114182293 14:20377279-20377301 GAGCTCTTGGCTTCTGCCTCAGG - Exonic
1115193290 14:30769866-30769888 CAGCTCCTGACTGGTGCCTCTGG - Intergenic
1115492573 14:33972574-33972596 CAGCACTTGTCTCCTGCCTGTGG - Intronic
1118836135 14:69479324-69479346 CAGCTCCTACCTCCTGACTTTGG - Intergenic
1118908872 14:70044914-70044936 CATCTCTTCTCTCCTGCCTCAGG + Exonic
1119032734 14:71205218-71205240 CAAGTCTTGCCTCCTACCTCAGG + Intergenic
1119436623 14:74601649-74601671 AAGCTCTTGGCTTCTGCCTCAGG - Intronic
1119662275 14:76460528-76460550 CAGCTCCTCCCTGCTCCCTCAGG + Intronic
1119859632 14:77926847-77926869 GAGCTCATTCCTCCTGGCTCAGG + Intronic
1120798925 14:88667923-88667945 CAGCTCTGGCCTGCTGCCTCTGG + Intronic
1122663092 14:103310926-103310948 CAGCCGGGGCCTCCTGTCTCGGG - Intergenic
1123479185 15:20615512-20615534 CAGATAATGCCTCCTCCCTCTGG - Intergenic
1123638829 15:22384873-22384895 CAGATAATGCCTCCTCCCTCTGG + Intergenic
1125205941 15:37153671-37153693 TAGCTCATGCCTCATGCCTATGG + Intergenic
1125736380 15:41929287-41929309 CAGCCTGTCCCTCCTTCCTCTGG + Intronic
1127491759 15:59471761-59471783 AAGCTTGTGCCTCTTGGCTCTGG + Intronic
1128375418 15:67071071-67071093 CAGCTCATGCCTCATACCTTTGG - Intronic
1129463905 15:75713121-75713143 CAGTTCATGCCTCCTCCCTGAGG - Intergenic
1132066235 15:98733293-98733315 CAGCCTCAGCCTCCTGCCTCTGG + Intronic
1132534518 16:471453-471475 CAGCTCGTGCCTCCTGCCTCCGG + Intronic
1132671948 16:1105690-1105712 CAGCCCATACCCCCTGCCTCTGG - Intergenic
1133015461 16:2937515-2937537 CAGATGGAGCCTCCTGCCCCTGG - Intronic
1133313079 16:4863734-4863756 CAGTTCGTTTCTCCTGACTCTGG + Intronic
1139368014 16:66445717-66445739 CATCTGGTCCCTACTGCCTCTGG - Intronic
1140532199 16:75676422-75676444 CAGATGATCCCTCCTGCCTCAGG + Intronic
1141370003 16:83478249-83478271 GAGCGTGTGCCTCCTGCCTCAGG - Intronic
1142066771 16:88067391-88067413 CAGCTCGAGTCTCCTCCCTGAGG - Intronic
1142187568 16:88701711-88701733 GAGCTGGGGCCTCCTGCCTATGG - Intronic
1142441855 16:90103624-90103646 CAGCTGGTTCCTCCTGGGTCTGG + Intergenic
1143029880 17:3961986-3962008 CAGCTGTTCCTTCCTGCCTCAGG - Intronic
1143112463 17:4560098-4560120 CAGCAGGTGCCTCCTGCACCAGG + Intronic
1143194240 17:5063358-5063380 CAACTGTTGCCTGCTGCCTCAGG + Intergenic
1143609290 17:8008293-8008315 CAGCTCCAGCCTCCAGTCTCTGG - Intronic
1144839900 17:18179432-18179454 CAACTCCTGCCTCCTCCCTCAGG - Exonic
1146636994 17:34513820-34513842 CCACTCCTTCCTCCTGCCTCTGG - Intergenic
1146902971 17:36600239-36600261 CATGGCTTGCCTCCTGCCTCTGG + Exonic
1147402859 17:40191524-40191546 CGGCGCGGGCCTCCGGCCTCCGG - Intronic
1147724739 17:42559758-42559780 CAGTTCAGCCCTCCTGCCTCAGG + Intergenic
1148249956 17:46068486-46068508 CAGCCTCTGCCTCCTGGCTCAGG - Intronic
1148742542 17:49901079-49901101 CAGCTCTTGTTTCCAGCCTCTGG - Intergenic
1148931155 17:51128397-51128419 CAGTCCCTGCCTCCTACCTCAGG + Intergenic
1150849883 17:68694559-68694581 CAGATCCTACCTCCTGACTCTGG - Intergenic
1152019793 17:77774750-77774772 CAGGACGTGGCTTCTGCCTCAGG + Intergenic
1152108215 17:78342756-78342778 CACCTCCTTCCTCCTGCATCAGG + Intergenic
1152814015 17:82397059-82397081 CAGCTCAGGCCACCTGCCACAGG + Intronic
1154394198 18:13971933-13971955 CAGCCCATGGCTCCTCCCTCAGG + Intergenic
1157283545 18:46361738-46361760 CAGCTCCTGGCTCCCGCCTGGGG - Intronic
1157582382 18:48781167-48781189 CTCCTAGTGCCTCCTGGCTCCGG + Intronic
1158282232 18:55840642-55840664 CACCTAGTGCCTCCTGCACCAGG + Intergenic
1160010819 18:75106021-75106043 CAGCCCCTGCCACCTGCCACAGG + Intergenic
1161014769 19:1978214-1978236 CCCCTCCTGCCTCCTGCCTCGGG + Intronic
1161333046 19:3697316-3697338 CAGCTCGGTCCTCCTCCGTCCGG - Intronic
1161333070 19:3697416-3697438 CAGCTCGGTCCTCCTCCGTCTGG - Intronic
1162651401 19:12091665-12091687 CTGCTCCTTCCTCCTGCATCAGG - Intergenic
1162802846 19:13120427-13120449 CAGTTTGTGGCTCCTGCCTCAGG - Intronic
1165055671 19:33174806-33174828 CAGCTCATGTCTCCTGCCATGGG - Intronic
1165089860 19:33379336-33379358 CAGCTGGTGCCTGCTGGCCCTGG + Exonic
1165976354 19:39680207-39680229 CTGCTCCTGCCTCCAGCCTCAGG + Intergenic
1165981470 19:39727886-39727908 CAACTTCTGCCTCCAGCCTCAGG - Intergenic
1165982576 19:39737154-39737176 TGGCTCCTGCCTCCAGCCTCAGG - Intronic
1166836659 19:45671348-45671370 CTGCCCGTGCGTCCTGCCCCTGG + Exonic
1166953775 19:46448098-46448120 CAGCTCCTCACCCCTGCCTCTGG - Intergenic
1168300844 19:55404244-55404266 GGCCTCCTGCCTCCTGCCTCTGG - Intronic
925376228 2:3388116-3388138 CAGCGCGCGCCCCCAGCCTCCGG + Exonic
925569911 2:5298094-5298116 CAGGTGGTGCCTCTTTCCTCAGG - Intergenic
925776047 2:7337249-7337271 CACCTAGTGCTTCCTGCCCCTGG - Intergenic
926045811 2:9708870-9708892 CAGGGGCTGCCTCCTGCCTCAGG - Intergenic
927721736 2:25387534-25387556 GGGCTGGTGCCTCCTGCCCCCGG - Intronic
931150849 2:59571546-59571568 CAGCTCCTCCCTTCTGCCTCTGG - Intergenic
931451390 2:62370199-62370221 CACCACATCCCTCCTGCCTCAGG - Intergenic
932232646 2:70095261-70095283 CAGCTTCTGCCTCCTGCCACAGG + Intergenic
932337017 2:70937369-70937391 CAGCACCTGCCTCAGGCCTCAGG - Intronic
932675775 2:73779818-73779840 CAGCTCGTGGCTTCTGGGTCTGG - Intronic
932977744 2:76624948-76624970 CTGCTCATGCCTCCCTCCTCTGG + Intergenic
934654566 2:96110418-96110440 CAGCTGGGCCCTCCTGCCACAGG + Intergenic
935765070 2:106359000-106359022 CTGTTCTTCCCTCCTGCCTCTGG + Intergenic
936467162 2:112764133-112764155 AAGCCCGGGTCTCCTGCCTCTGG - Intronic
937093645 2:119222772-119222794 CAGCTCCTGCCTCTGGCCTCCGG + Intergenic
937892001 2:126946182-126946204 CACCTCGTGTCTCATGCCTTTGG - Intergenic
938577785 2:132620229-132620251 GAGCTGCAGCCTCCTGCCTCCGG - Intronic
940900684 2:159123884-159123906 CCCCTCGTGCCCCCAGCCTCAGG + Intronic
942248024 2:174025277-174025299 CAGCTCTGGTCTCCTGACTCTGG + Intergenic
942945357 2:181666354-181666376 CAGCTCTTGGCTCTAGCCTCTGG + Intronic
943060038 2:183032966-183032988 CAGCCTCTGCCTCCTGGCTCAGG - Intronic
943892180 2:193302733-193302755 CAGCTGATGCCACCTGCATCAGG + Intergenic
944585729 2:201171831-201171853 CAGCTCATATCTCCTACCTCTGG + Exonic
946326488 2:218987066-218987088 CAGCTCTTACCTCCTGCCCCTGG - Intergenic
947129386 2:226905584-226905606 CACCACTTGCCTTCTGCCTCAGG + Intronic
947514649 2:230791694-230791716 CAGCTTGCTCCTCCTGTCTCAGG + Intronic
948106828 2:235421308-235421330 CACCTCTGGGCTCCTGCCTCAGG - Intergenic
948524089 2:238559790-238559812 CAGCACTTGCCTCCTGCGGCGGG + Intergenic
948863792 2:240765396-240765418 AAGCTCCTGCCTCCTGGCCCAGG - Intronic
1168837763 20:889037-889059 CAGCACGTCCATCCTCCCTCCGG + Intronic
1172273346 20:33666892-33666914 CAGCTCTTGGCTCCGCCCTCTGG - Exonic
1172655207 20:36532591-36532613 CAGCTCTTGCCTCCACTCTCAGG + Intergenic
1174169095 20:48605135-48605157 CAGCCCGTGCCTCCCTCCCCAGG - Intergenic
1174340609 20:49892808-49892830 CAGCTCTTGCCCCCTGGCTGGGG - Intergenic
1175510016 20:59517663-59517685 CAGCCTGACCCTCCTGCCTCTGG - Intergenic
1175867086 20:62184633-62184655 CTGCTCCTGCCTCCAGTCTCTGG + Intronic
1176050313 20:63115855-63115877 CAGCCCCTGGCTGCTGCCTCTGG - Intergenic
1176709321 21:10136018-10136040 CAGCTCAAGGCTCCTGCTTCAGG + Intergenic
1178098118 21:29237154-29237176 GAGATGGTTCCTCCTGCCTCTGG - Intronic
1178928406 21:36794882-36794904 CAGCCCTTGCCTCCTGCTTTTGG - Intronic
1179491930 21:41746441-41746463 CAGCACCTGCCTGCGGCCTCTGG - Intronic
1180001299 21:44996693-44996715 CAGCCCCTTCCTCCTGCCACAGG - Intergenic
1180780812 22:18518421-18518443 CAGCCTATGCCACCTGCCTCAGG - Intergenic
1180813525 22:18775728-18775750 CAGCCTATGCCACCTGCCTCAGG - Intergenic
1181311967 22:21949790-21949812 CAGCTGGTTCCTCCTGGATCAGG + Intronic
1181419384 22:22787224-22787246 CATCTCGAGTCTCCTGCTTCAGG - Intronic
1181712146 22:24697385-24697407 CAGCTCTATCCTCCTGGCTCAGG + Intergenic
1183597296 22:38820384-38820406 CAGCTCTTGCATCATGTCTCAGG + Exonic
1184358612 22:43999527-43999549 CAGCTCCAGCCTCCTGCTGCAGG - Exonic
1184744990 22:46451006-46451028 CAGAGGGTGCCTCCTGTCTCAGG - Intronic
1184813212 22:46851491-46851513 CATCGAGGGCCTCCTGCCTCAGG - Intronic
1185255457 22:49828483-49828505 CAGCTGGTCCCCCCCGCCTCAGG - Intergenic
1203227126 22_KI270731v1_random:84861-84883 CAGCCTATGCCACCTGCCTCAGG + Intergenic
949522824 3:4872381-4872403 CAGCTTCTGCTTCCTCCCTCTGG + Intronic
950528815 3:13540635-13540657 CAGTTCCTGGCTCCTTCCTCTGG + Intergenic
950918073 3:16665588-16665610 CAGCTCCTGCCTCCTCCCGCAGG - Intronic
953263160 3:41359519-41359541 CAGCCAGTGACTCCTGCTTCAGG - Intronic
953901298 3:46845652-46845674 CAGCTCAAGCCTCCCGCCTCAGG - Intergenic
955215171 3:56979400-56979422 AAGCTCGTTCCTGCTGCCACAGG + Intronic
957743069 3:84299743-84299765 AAGCTCCTGCCCCCTGCCACAGG + Intergenic
962331867 3:134485720-134485742 CAGCTGCGGCTTCCTGCCTCAGG + Exonic
963261832 3:143200437-143200459 CAGCTCATGCCTCCTACATGAGG - Intergenic
965757335 3:172040018-172040040 CCGCCTGTGCCCCCTGCCTCAGG + Intronic
966696456 3:182794081-182794103 CCGCTCGGGACTCCCGCCTCTGG - Intronic
968362120 3:198154591-198154613 CAGCTGGTTCCTCCTGGGTCTGG + Intergenic
968508430 4:983259-983281 CTTCTCCTGCCTCCTGTCTCTGG + Intronic
968904774 4:3446117-3446139 CTTCTTGTGCCTCCTGCCGCAGG - Exonic
968911171 4:3477670-3477692 CCGCACGTGCCTCCTGCAGCTGG - Intronic
969284366 4:6193626-6193648 CGCATCGTCCCTCCTGCCTCGGG + Intronic
969470679 4:7385719-7385741 CAGCTCCAGGCTCCTGCCTCGGG + Intronic
969543927 4:7811565-7811587 CCCCTGGTGTCTCCTGCCTCGGG + Intronic
969655826 4:8497942-8497964 CAGCTCCTGCTCCCTGCCCCTGG - Intergenic
971792367 4:31185227-31185249 CAGCTGGTGCCGCCGGCCCCAGG - Intergenic
974650590 4:64748942-64748964 CCGCTCTTGCCACGTGCCTCTGG - Intergenic
977708580 4:100098884-100098906 CTGCCTGTGCCCCCTGCCTCTGG + Intergenic
978406391 4:108383407-108383429 CAGTTGGTGGCTCCTGCCTTGGG - Intergenic
981636516 4:146887046-146887068 CAACTCCTCCCTCCTGCCCCTGG - Intronic
982236185 4:153253186-153253208 CCTCTCCTGCCTCCTGCCCCTGG - Intronic
986757834 5:10854610-10854632 CAGCTCTTCCCTGCTGCCACAGG + Intergenic
991967410 5:72107136-72107158 CACCTCGTCCCTCCAGCTTCCGG + Intergenic
996081400 5:119261969-119261991 CAGATCTTGGCTCCTCCCTCTGG + Intergenic
997262683 5:132476594-132476616 AAGCTTGTGCGGCCTGCCTCAGG - Intergenic
997369666 5:133350432-133350454 CAGATCTTCCCTCCAGCCTCAGG + Intronic
997505287 5:134412037-134412059 CAGCCCGTGGCTCCTGCCCTGGG + Intergenic
997653300 5:135537470-135537492 CAGCGCTTGCCTTCTGGCTCAGG + Intergenic
997904997 5:137807624-137807646 CAGTCCCTGTCTCCTGCCTCGGG + Intergenic
998193160 5:140043559-140043581 CAGGGCGTGCCCCCTGCCTTTGG + Intergenic
1001399461 5:171437881-171437903 GAGCTCCCGCCTCCTGTCTCAGG - Intronic
1002468483 5:179420547-179420569 GGGCTGGTGCCTCCTCCCTCTGG - Intergenic
1004456196 6:15793582-15793604 CAGCCCCTGCCTCATGCCTGGGG - Intergenic
1004880821 6:20005732-20005754 CAGCTCTTACCTCAGGCCTCAGG - Intergenic
1005303860 6:24495361-24495383 CAGCTCTGGCCCCCTGCATCCGG - Intronic
1005755472 6:28921900-28921922 CAGCTCGTGCCTGTTCCCCCTGG + Exonic
1006024778 6:31139816-31139838 CAGCCCCTTCCTCCTCCCTCAGG + Exonic
1006154252 6:32005773-32005795 CACCTCCTGCCTCTTGCCCCGGG + Intergenic
1006445549 6:34077787-34077809 CAGCTCGGGCCTCCTCCTCCAGG + Intronic
1006581718 6:35081269-35081291 AGGCTAGTGCCTCCTGACTCTGG - Intronic
1007547051 6:42702322-42702344 CAGCCAGTGCATCCTGCCTGTGG - Intronic
1018031707 6:159846370-159846392 CAGCCAGTGTCTCCTGACTCAGG + Intergenic
1018159186 6:161021318-161021340 CTGCTCCTGCCTGCTGCTTCTGG + Intronic
1018198711 6:161376698-161376720 CACCTCTAGCCTCCTACCTCTGG + Intronic
1018229951 6:161665958-161665980 CTGCTCCTGCCTCCTGGCTCAGG + Intronic
1019119697 6:169793003-169793025 CACCTGGTGCCTCCTGTCTGCGG - Intergenic
1019253560 7:34116-34138 CAGCTGGTTCCTCCTGGGTCTGG - Intergenic
1019290164 7:246337-246359 CAGCACGTCCCGCCTGCCTCCGG + Intronic
1019419645 7:945131-945153 CAGCCCGTCCCTTCTGCCTTGGG - Intronic
1019819604 7:3232456-3232478 CAGCTCATTCCTGCTGCCTTAGG + Intergenic
1020280795 7:6649035-6649057 CAGCTCCTGTCACCTGCCGCTGG + Intronic
1021434378 7:20597757-20597779 CATCACGCGCCTCCTGCTTCAGG - Intergenic
1024015681 7:45312124-45312146 CTGCTGCTGCCTGCTGCCTCCGG - Intergenic
1024992902 7:55250431-55250453 CAGCCCTTGCCTCCTTTCTCCGG - Intronic
1025251399 7:57353690-57353712 CAGCTCTTGACTCCTTCCTTAGG - Intergenic
1027562608 7:79751220-79751242 CATGTCTTGCCTCCTGCCACAGG + Intergenic
1029611827 7:101630671-101630693 TAACTCCTGCTTCCTGCCTCTGG + Intergenic
1029706624 7:102279846-102279868 TGGCTGGTGCCTCCTGCCACAGG - Intronic
1033536608 7:142318246-142318268 CATCTCCTGGCTCCTTCCTCAGG - Intergenic
1033586459 7:142778369-142778391 CAGTCCCTGCCTCCTTCCTCGGG + Intergenic
1033685511 7:143636755-143636777 CAGCTCCAGTCTCATGCCTCTGG + Intronic
1033688681 7:143715972-143715994 CAGCTCCAGTCTCATGCCTCTGG + Intronic
1033699103 7:143820866-143820888 CAGCTCCAGTCTCATGCCTCTGG - Intergenic
1034307819 7:150059832-150059854 CAGCTCTTCCCTCCTGCCCCGGG - Intergenic
1034799029 7:154040837-154040859 CAGCTCTTTCCTCCTGCCCCGGG + Intronic
1038335439 8:26641857-26641879 CAGCTGCCCCCTCCTGCCTCAGG - Intronic
1039601637 8:38843568-38843590 CTGCTCCTGCCTCCTTCCACTGG + Intronic
1039854228 8:41398633-41398655 CTTCTCTTGCCTCCTTCCTCAGG + Intergenic
1039920563 8:41891387-41891409 CAGCTCGTGTCCCCTGCCCAGGG + Intronic
1041839184 8:62249000-62249022 CCGCTGCTGCCTCCTGACTCCGG - Exonic
1043034287 8:75177581-75177603 CAGCAGTTTCCTCCTGCCTCAGG - Intergenic
1043388314 8:79768523-79768545 CAGCGCGCGCCTCCAGCCGCCGG - Intergenic
1047815739 8:128460394-128460416 CAGCTCAGGCCTCTTGCCTCTGG - Intergenic
1048328072 8:133453736-133453758 CTGCTCCTGCCCCCTGCCACGGG - Intergenic
1049157064 8:141073735-141073757 CAGCTCCTGCCTGCAGCCCCAGG + Intergenic
1049543881 8:143220706-143220728 AGGCTCCTGCCCCCTGCCTCAGG + Intergenic
1049562379 8:143318187-143318209 CTGCTCGGGCCACCTTCCTCAGG - Intronic
1049990064 9:981977-981999 CACCTCGGGACTCCTGCCTTGGG - Intronic
1050209759 9:3240085-3240107 CAGCCCGTGTCGCCAGCCTCTGG - Intronic
1050411648 9:5372592-5372614 CAGCTACTGCCTCCTGCCACAGG + Intronic
1051605274 9:18912119-18912141 CAGCTCCTCCCTCCTGCCGTGGG - Intergenic
1052937691 9:34106725-34106747 TAGCTCTTGCCTTCTACCTCTGG + Intronic
1055111792 9:72567051-72567073 CTGCTTATGTCTCCTGCCTCAGG + Intronic
1057228659 9:93305679-93305701 GGGCTCATGCCTCCTGCCTCGGG - Intronic
1057968990 9:99535160-99535182 CAGTTTGTGCCTTCTGCCTGTGG - Intergenic
1059059042 9:111015527-111015549 CATCCCTTGCCTCCAGCCTCTGG - Intronic
1060204737 9:121675800-121675822 CAGCACATGCCACCTCCCTCTGG - Intronic
1060407987 9:123382126-123382148 CTGCTCGTGCCTGCAGCCCCGGG + Exonic
1062031873 9:134365492-134365514 CTGCCCCTGCCTCCTGTCTCTGG + Intronic
1062295922 9:135826494-135826516 CAACTCCTTCCTCCTGACTCCGG + Intronic
1062594522 9:137293071-137293093 CAGCTCATTCCTCCTTCCTCTGG + Intergenic
1062746807 9:138218253-138218275 CAGCTGGTTCCTCCTGGGTCTGG + Intergenic
1186026952 X:5323797-5323819 CAGCTCTTGCTTCCAGCTTCTGG + Intergenic
1187365382 X:18662010-18662032 CAGCGCGTGGTCCCTGCCTCGGG - Intronic
1187968095 X:24632514-24632536 CAGCTTGTGCCTGCTGCCTAGGG + Intronic
1189225887 X:39412975-39412997 CAGCACATGTTTCCTGCCTCTGG + Intergenic
1190053792 X:47170536-47170558 CAGCTCCTGCTGCCTGGCTCTGG + Intronic
1190743163 X:53303750-53303772 CAGATCGTGCCACTTGACTCCGG + Intronic
1190947266 X:55108130-55108152 CGGCTCCTACTTCCTGCCTCAGG - Intronic
1191741513 X:64440185-64440207 CAGCTAGTGTCTCCTCCTTCAGG + Intergenic
1192487009 X:71536378-71536400 CTGCTCGTGATTGCTGCCTCTGG + Intronic
1199082813 X:143595386-143595408 CAGCAGGAGCCTCCTGGCTCTGG - Intergenic
1200067505 X:153510966-153510988 CAGCTCTGGGCTCCTGCCTCGGG - Intergenic
1200372158 X:155738988-155739010 CATCTCCAGCCTGCTGCCTCTGG - Intergenic
1200780337 Y:7209905-7209927 TAGCTCGTCCCACCTTCCTCAGG - Intergenic