ID: 1132534529

View in Genome Browser
Species Human (GRCh38)
Location 16:471510-471532
Sequence CACGGTGCACACAGGGCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 141}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132534529_1132534540 -2 Left 1132534529 16:471510-471532 CCTCCCGCCCTGTGTGCACCGTG 0: 1
1: 0
2: 1
3: 10
4: 141
Right 1132534540 16:471531-471553 TGGGGCTCTGTGGCTGTGACGGG 0: 1
1: 0
2: 1
3: 35
4: 545
1132534529_1132534541 1 Left 1132534529 16:471510-471532 CCTCCCGCCCTGTGTGCACCGTG 0: 1
1: 0
2: 1
3: 10
4: 141
Right 1132534541 16:471534-471556 GGCTCTGTGGCTGTGACGGGAGG 0: 1
1: 0
2: 2
3: 34
4: 996
1132534529_1132534539 -3 Left 1132534529 16:471510-471532 CCTCCCGCCCTGTGTGCACCGTG 0: 1
1: 0
2: 1
3: 10
4: 141
Right 1132534539 16:471530-471552 GTGGGGCTCTGTGGCTGTGACGG 0: 1
1: 0
2: 2
3: 51
4: 626

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132534529 Original CRISPR CACGGTGCACACAGGGCGGG AGG (reversed) Intronic
900001186 1:15718-15740 CCCGGTGGACTCAGGGCTGGAGG + Intergenic
900020901 1:186239-186261 CCCGGTGGACTCAGGGCTGGAGG + Intergenic
900185540 1:1331515-1331537 CCTGGTGCACACAGGGCTGCTGG - Exonic
902225204 1:14992363-14992385 CACGGTGCTCACACGGGGTGAGG - Intronic
902373740 1:16020462-16020484 CCTGGTGCACACAGGGCTGGGGG + Intronic
902378659 1:16042297-16042319 CCTGGGGCACACAGGGCTGGGGG + Intergenic
902822791 1:18953786-18953808 CAAGTTGCACCCAGGGCGTGGGG - Intronic
906776708 1:48536313-48536335 CAGGGTGCTCACAGGGGTGGAGG + Intronic
919981785 1:202646376-202646398 CACAGGGCACACAGGGAGAGGGG - Intronic
922807180 1:228396391-228396413 GAAGGTGCACCCAGGGAGGGTGG + Intronic
924415456 1:243851264-243851286 CACGGTACACAGATTGCGGGCGG + Intergenic
1063423052 10:5928995-5929017 CAGGGTGCAGGCAGGGTGGGCGG + Intronic
1065431813 10:25666175-25666197 CACAGTTCATACAGGGTGGGAGG - Intergenic
1067433941 10:46264362-46264384 CACAGGGGACACAGGGCAGGTGG + Intergenic
1067581901 10:47451534-47451556 CACAGGGGACACAGGGCAGGTGG - Intergenic
1070689839 10:78516412-78516434 CCAGCTGCACACAGGGCAGGAGG - Intergenic
1070917693 10:80165354-80165376 CAGGGTGCACACAGAGCTGTGGG + Intronic
1071533834 10:86411097-86411119 CAAGGCCCACACAGGGAGGGAGG - Intergenic
1075025460 10:118980318-118980340 CCCGTTTCCCACAGGGCGGGGGG - Intergenic
1075886417 10:125903331-125903353 CTCTGTGCTCACAGGGCTGGGGG + Intronic
1078845456 11:15115285-15115307 CACAGTGCACCCAGGGCAGCAGG - Intronic
1080042069 11:27769470-27769492 CAGGGTGCAGAAAGGGTGGGAGG + Intergenic
1080418556 11:32091289-32091311 CACGGTGCGCAAAGAGCGCGTGG + Exonic
1083659837 11:64246878-64246900 CGCGGGGGACAAAGGGCGGGCGG - Exonic
1083680860 11:64351315-64351337 CACGGTGGACCCTGGGCTGGGGG + Intronic
1084568351 11:69944295-69944317 CAGGGTGCGGACAGGGCAGGAGG + Intergenic
1084730839 11:71072339-71072361 CACGGTGCACACACTGGGCGGGG + Intronic
1084957132 11:72697462-72697484 CACTGTACATACAGGGCGAGCGG - Exonic
1085320668 11:75572089-75572111 CAGGGTGCACACAGGATGGCAGG + Exonic
1088877423 11:113947505-113947527 CAAGGTGCAAACAGGGTGGGTGG + Intergenic
1089663525 11:120001570-120001592 CAGAGAGCACACAGGGCAGGTGG - Intergenic
1090024968 11:123159674-123159696 CAGGGGGCACACAGGAAGGGTGG + Intronic
1091374275 12:15835-15857 CCCGGTGGACTCAGGGCTGGAGG + Intergenic
1104256804 12:127146443-127146465 CACGGTGGACTCAGCCCGGGAGG + Intergenic
1104969411 12:132524419-132524441 CAGGGTGCACACAAGGCAGACGG - Intronic
1105307579 13:19180045-19180067 CTCGGAGAGCACAGGGCGGGTGG - Intronic
1106308229 13:28532295-28532317 CAGGGTGGACAGCGGGCGGGTGG - Intergenic
1107634756 13:42381001-42381023 CAGGGTGCACAGAGGGGAGGGGG + Intergenic
1107731199 13:43350756-43350778 CCCTGTGCACACAAAGCGGGAGG - Intronic
1107942979 13:45391234-45391256 CACGGTGCGCAAAGAGCGCGTGG - Intergenic
1112066605 13:95799750-95799772 CAAGATGCAAACAGGGAGGGGGG + Intergenic
1113435932 13:110291001-110291023 AGAGGTGCTCACAGGGCGGGTGG + Intronic
1118846011 14:69548270-69548292 CAGGGAGCACAGAGAGCGGGGGG - Intergenic
1121104519 14:91271816-91271838 CACTGTGCACACTGGCCTGGAGG + Exonic
1121632755 14:95432959-95432981 GACGGTGCACACAGGGCCCTCGG + Intronic
1202871665 14_GL000225v1_random:170590-170612 CTCTGTGCTCACAGGGCTGGGGG - Intergenic
1123919755 15:25062053-25062075 CACGGTGCACCCCGTGCTGGCGG + Intergenic
1129887328 15:79047805-79047827 CACGGTCCACACTGGGAGGAAGG + Intronic
1132452323 15:101975221-101975243 CCCGGTGGACTCAGGGCTGGAGG - Intergenic
1132454573 16:15402-15424 CCCGGTGGACTCAGGGCTGGAGG + Intronic
1132534529 16:471510-471532 CACGGTGCACACAGGGCGGGAGG - Intronic
1132592961 16:734357-734379 CAGGGGGCACACGGGGCTGGCGG + Intronic
1138619487 16:58199411-58199433 CACGGTGGTCTCAGGGAGGGAGG - Intergenic
1142030021 16:87833816-87833838 GCCGCTGCACACAGGGCCGGGGG + Intronic
1142298350 16:89241461-89241483 CACAGGGCACACAGGGCAGACGG + Intergenic
1142364342 16:89642033-89642055 CACGGTCCACAAAGCTCGGGGGG - Intergenic
1146004981 17:29155419-29155441 CAGGGTCCACACAGGGCGGCAGG - Intronic
1146482848 17:33218853-33218875 CACAGTGATAACAGGGCGGGGGG + Intronic
1147944209 17:44071111-44071133 CGCGATGCCCACACGGCGGGAGG - Exonic
1152439646 17:80298213-80298235 CACCGTGCACACAGAGCAAGAGG - Intronic
1152650432 17:81490077-81490099 CAAGGTGCTCTCAGGGAGGGAGG + Intergenic
1153945997 18:10017913-10017935 CACGATGCACACTGGCCAGGTGG - Intergenic
1154494140 18:14943663-14943685 CACTGTGCACCCAGGCCGGATGG - Intergenic
1157161357 18:45317097-45317119 CACAATGCACACAGGGCTAGAGG - Intronic
1157572984 18:48725212-48725234 CACGGTGCAAAGAGGCTGGGCGG + Intronic
1160145442 18:76360040-76360062 CAGGGTGCACAGAGTGCAGGAGG - Exonic
1161170303 19:2809229-2809251 CACGTTGAACACATGGCTGGTGG + Intronic
1161571850 19:5035196-5035218 CCTGGTGCACATAGGGCAGGTGG + Intronic
1162954419 19:14090426-14090448 CACGGTGCAGCCGGGCCGGGCGG - Exonic
1165158795 19:33803896-33803918 CCTTGTGCACACAGGGCAGGTGG + Intronic
1165383035 19:35494502-35494524 CACCGGGCACATAGGGTGGGCGG - Intronic
1166669889 19:44703545-44703567 CCCGGCCCACACGGGGCGGGAGG + Exonic
1166670713 19:44708039-44708061 CCCCGCGCACACAGGCCGGGAGG + Exonic
1168639585 19:58021774-58021796 TACGGTTCACACAGCGCGGACGG + Intergenic
927519755 2:23691624-23691646 CACGGTGGCCGCAGGGCAGGAGG + Intronic
930071611 2:47370100-47370122 CCCGGACCACACAGGGCGTGTGG + Intronic
936568539 2:113597694-113597716 CCCGGTGGACTCAGGGCTGGAGG - Intergenic
937305187 2:120866637-120866659 CACCTGGCAGACAGGGCGGGTGG + Intronic
941333522 2:164210465-164210487 CAAGGTGTCCACAGGGCTGGGGG - Intergenic
945241525 2:207681363-207681385 CGCGGGGGACAAAGGGCGGGCGG + Intergenic
948601743 2:239111461-239111483 CACAGTGGGCACAGCGCGGGGGG - Intronic
948643011 2:239387313-239387335 CCCGGTGCACCCAGGCCAGGAGG + Intronic
948728885 2:239951229-239951251 CGGGGTGCCCACAGGGCGTGCGG + Intronic
948795795 2:240401510-240401532 CCCTGTGCCCACAGAGCGGGAGG + Intergenic
948941574 2:241199577-241199599 CACTGGGCAAACAGGGCAGGTGG + Intronic
1168830362 20:842175-842197 CAAGGCGCACAGCGGGCGGGTGG + Intronic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1174534149 20:51237802-51237824 CACCATGCTCACAGGGAGGGCGG - Intergenic
1175156718 20:56976430-56976452 CACGGTGCTCACAGGCTGGTGGG - Intergenic
1175371667 20:58496651-58496673 CATGGGGCAGACAGGCCGGGAGG + Intronic
1176134874 20:63518122-63518144 CAGGCTTCCCACAGGGCGGGAGG - Intergenic
1179996298 21:44975962-44975984 CACGGGGCACACAGGCCGGAGGG + Intronic
1180007971 21:45032040-45032062 CACTGTGCACACAGCTCTGGGGG + Intergenic
1180024679 21:45153718-45153740 CACGGTGCACAGAGGGCCCAGGG - Intronic
1180286423 22:10748844-10748866 CTCTGTGCTCACAGGGCTGGGGG + Intergenic
1181477968 22:23180409-23180431 CGCCGTGGGCACAGGGCGGGGGG - Exonic
1182647527 22:31822428-31822450 CATAGGGCAGACAGGGCGGGTGG + Intronic
1183064269 22:35352779-35352801 CACGGTGCACAGAGGGTGCAGGG - Intergenic
1183455809 22:37922432-37922454 CAGGGTGCAGTCAGGGCAGGGGG + Intronic
1183675573 22:39297214-39297236 CAGCGTGGAGACAGGGCGGGAGG + Intergenic
1184400138 22:44268896-44268918 CACAGTGCACACAGCCCTGGAGG - Intronic
1184769651 22:46589781-46589803 CAGGGTGCACACAAAGCAGGTGG - Intronic
1185075525 22:48680122-48680144 CTCCTTGCACACAGGGTGGGGGG - Intronic
954317656 3:49810014-49810036 CACGGTACAGACAGGGTAGGGGG + Exonic
954763354 3:52893566-52893588 CACAGAGCACACAGGGAGGCCGG + Intronic
960811302 3:121629917-121629939 GACTGTGTACACAGGGAGGGAGG + Exonic
960966647 3:123110343-123110365 CACGGAGCACACAGGGCAGAAGG - Intronic
966314857 3:178633577-178633599 CACAGTGGTCACAGGGTGGGTGG + Intronic
968231812 3:197008887-197008909 CACAGTGCACACAGCGAGGAGGG + Exonic
968483991 4:849996-850018 CACGCTGCACACAGTGCTGTGGG - Exonic
968972558 4:3803614-3803636 CTCGGTGCGCACAGGGCTGTGGG - Intergenic
970813878 4:20129833-20129855 CACAGTGCATACAGAGCGGGGGG + Intergenic
976828153 4:89283490-89283512 CATGGTACACACAAGGTGGGTGG + Intronic
985520952 5:373739-373761 CCGGGTGCACACGGGGCGGGCGG - Intronic
985966017 5:3339217-3339239 CACGGTGCACAAAGAGCAGAGGG + Intergenic
986013413 5:3737486-3737508 CACGGTGGTTGCAGGGCGGGTGG - Intergenic
986154865 5:5164608-5164630 CACGGTGAGCCCAGGGCTGGCGG - Intronic
991085918 5:62648346-62648368 CACAGTGCACCCTGGCCGGGAGG + Intergenic
991360038 5:65810456-65810478 CATGATGCATACAGGGAGGGAGG - Intronic
1006146314 6:31961825-31961847 CATGGAGCACGCAGGGCGGGCGG - Intronic
1009338628 6:62526086-62526108 CACTGTGCACAGAGGGGTGGTGG - Intergenic
1015763073 6:136685882-136685904 CAAGGTGCTCACAGGGAGGAGGG - Intronic
1015937580 6:138418617-138418639 CACTGTGCAGACATGGCGGTTGG - Exonic
1016548754 6:145253759-145253781 CACAGTGCACACATTGAGGGTGG + Intergenic
1017889338 6:158626017-158626039 CACGCTGCACACATAGCAGGTGG - Intronic
1019480499 7:1264582-1264604 CAGGGTGCACACAGGGTGGGTGG - Intergenic
1019499458 7:1357806-1357828 CACGGGACACCCAGGGAGGGTGG + Intergenic
1020094682 7:5361786-5361808 CACGATGCACACACGGCGCCGGG + Intronic
1022286281 7:28958049-28958071 GCCGCTGCACGCAGGGCGGGAGG - Exonic
1026392376 7:69914514-69914536 CACGGTCCACGCAGGGCGCAGGG - Intronic
1027181806 7:75946000-75946022 CAGGGAGCACACAGGCTGGGGGG - Intronic
1031979392 7:128115042-128115064 CAGGCTGGACACAGGGAGGGAGG - Intergenic
1032119297 7:129144911-129144933 CGCGGGGCACACAGGCCGGCCGG + Exonic
1032237975 7:130141122-130141144 CCCCGTGCACACCGGGCGGGAGG - Intergenic
1035238697 7:157516491-157516513 CAGGGTGCTGACAGGGAGGGTGG + Intergenic
1035860898 8:3026624-3026646 CACGGTGTTGACAGGGCTGGAGG - Intronic
1037974645 8:23200761-23200783 CTGGGTACACACAGGGAGGGAGG + Intronic
1038420571 8:27431534-27431556 GAAGGGGCAGACAGGGCGGGAGG - Intronic
1039892895 8:41696668-41696690 CCCGGTGCATACAGGGTGAGTGG - Exonic
1039913565 8:41843529-41843551 CATGGTGCAGACAGGGCAGCTGG + Intronic
1049757379 8:144316739-144316761 CATGGTGACCACAGGGCTGGGGG + Intronic
1049883991 9:15831-15853 CCCGGTGGACTCAGGGCTGGAGG + Intergenic
1052861394 9:33439939-33439961 CATGGTCCAGAGAGGGCGGGTGG - Intergenic
1052963400 9:34319661-34319683 CAGGGTGCACACAGGATGGCAGG + Intronic
1056930109 9:90867261-90867283 CACAGGGCAGACTGGGCGGGCGG - Intronic
1059790126 9:117633484-117633506 CACGGTGCACACAGCTTGAGAGG + Intergenic
1060016913 9:120094666-120094688 CAGGGGACACACAGGGCGGGGGG + Intergenic
1060357114 9:122919563-122919585 AACGGTGCACACAGGCCCTGTGG - Exonic
1061359575 9:130132421-130132443 CAGGGTGGACACAGGACGGCAGG - Intronic
1061368971 9:130187307-130187329 CACGGTGCTCAGAGAGCAGGAGG - Intronic
1062236496 9:135512392-135512414 GACAGTACACTCAGGGCGGGGGG + Intergenic
1203732783 Un_GL000216v2:106009-106031 CTCTGTGCTCACAGGGCTGGGGG + Intergenic
1202628165 Y:56881663-56881685 CTCTGTGCTCACAGGGCTGGGGG - Intergenic