ID: 1132536252

View in Genome Browser
Species Human (GRCh38)
Location 16:482604-482626
Sequence CTCAGGGTGCACCAGGGTGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 1, 2: 0, 3: 17, 4: 249}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132536252_1132536255 -9 Left 1132536252 16:482604-482626 CCAGCACCCTGGTGCACCCTGAG 0: 1
1: 1
2: 0
3: 17
4: 249
Right 1132536255 16:482618-482640 CACCCTGAGCTGCAACCTGAAGG 0: 1
1: 0
2: 1
3: 29
4: 187
1132536252_1132536261 9 Left 1132536252 16:482604-482626 CCAGCACCCTGGTGCACCCTGAG 0: 1
1: 1
2: 0
3: 17
4: 249
Right 1132536261 16:482636-482658 GAAGGGGACGCAGACAGTGCCGG 0: 1
1: 0
2: 2
3: 15
4: 244
1132536252_1132536256 -8 Left 1132536252 16:482604-482626 CCAGCACCCTGGTGCACCCTGAG 0: 1
1: 1
2: 0
3: 17
4: 249
Right 1132536256 16:482619-482641 ACCCTGAGCTGCAACCTGAAGGG 0: 1
1: 0
2: 1
3: 15
4: 138
1132536252_1132536263 17 Left 1132536252 16:482604-482626 CCAGCACCCTGGTGCACCCTGAG 0: 1
1: 1
2: 0
3: 17
4: 249
Right 1132536263 16:482644-482666 CGCAGACAGTGCCGGCGGCTCGG 0: 1
1: 0
2: 0
3: 2
4: 94
1132536252_1132536258 -7 Left 1132536252 16:482604-482626 CCAGCACCCTGGTGCACCCTGAG 0: 1
1: 1
2: 0
3: 17
4: 249
Right 1132536258 16:482620-482642 CCCTGAGCTGCAACCTGAAGGGG 0: 1
1: 0
2: 2
3: 16
4: 238
1132536252_1132536262 12 Left 1132536252 16:482604-482626 CCAGCACCCTGGTGCACCCTGAG 0: 1
1: 1
2: 0
3: 17
4: 249
Right 1132536262 16:482639-482661 GGGGACGCAGACAGTGCCGGCGG 0: 1
1: 0
2: 0
3: 12
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132536252 Original CRISPR CTCAGGGTGCACCAGGGTGC TGG (reversed) Exonic