ID: 1132538683

View in Genome Browser
Species Human (GRCh38)
Location 16:497006-497028
Sequence CTGAAGGAGTGTTGGGAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 388
Summary {0: 1, 1: 0, 2: 0, 3: 38, 4: 349}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132538683 Original CRISPR CTGAAGGAGTGTTGGGAAAG GGG Intronic
900797163 1:4715079-4715101 TGGAAGGAGTGCTGGGACAGAGG + Intronic
901119329 1:6877631-6877653 CTGAAGATGTGTGCGGAAAGTGG - Intronic
901403470 1:9030868-9030890 ATGAATGAGTCTTGGTAAAGAGG - Intergenic
901863472 1:12089205-12089227 TGGAAGGAGTGTTAGGAAAGTGG - Intronic
902040822 1:13491056-13491078 CTGAAGGGTTGTTGGGCAAGAGG - Intronic
902893439 1:19461718-19461740 CTGAAGAAGAGTTTGGAATGGGG + Intronic
903283946 1:22265718-22265740 ATGAAGGAATGTTGGCATAGTGG - Intergenic
903426852 1:23259973-23259995 CTGAAGGACTGTGGGGAACAGGG + Intergenic
904229744 1:29058670-29058692 CTGAGGGGGTGGAGGGAAAGAGG - Intronic
905180924 1:36166095-36166117 CTGAAGGAGGGGAGGGAACGAGG + Intronic
905457871 1:38100797-38100819 CTGATGAGGGGTTGGGAAAGAGG + Intergenic
905650036 1:39650163-39650185 CTGAAGGAATGTTGGACAGGAGG + Intergenic
906439364 1:45827444-45827466 ATAAAGGCCTGTTGGGAAAGAGG - Intronic
906555880 1:46713188-46713210 CTGAGGGAGGGTAGGGAATGGGG - Intronic
906671145 1:47655840-47655862 TTCGAGGAGTGGTGGGAAAGAGG - Intergenic
907235937 1:53047733-53047755 CTGAGGCAGTGTGGGGAAATGGG - Intronic
907526461 1:55056767-55056789 CTGGAGGAGTGGTGGGTCAGAGG - Intronic
907550727 1:55302618-55302640 CAGAAGGATTATTGGAAAAGGGG - Intergenic
907703990 1:56817202-56817224 GTGAAGGAGTGTTCAGAGAGTGG - Intronic
908475540 1:64484188-64484210 CTGAAGCAGTGATGGAAAGGAGG + Intronic
910541783 1:88367345-88367367 CTGAAAGAGAGTTGAGGAAGAGG - Intergenic
910799859 1:91134142-91134164 CTGAAGGAGTCTGGGGAGACGGG + Intergenic
913262338 1:117010900-117010922 CTGAGGATGTGGTGGGAAAGAGG - Intronic
915467057 1:156104026-156104048 CTGAAGGAGGGATTGGGAAGGGG + Intronic
915971512 1:160358458-160358480 GGGAAGGGGTGATGGGAAAGGGG - Exonic
917027397 1:170659292-170659314 CAGAAGGAATGGTTGGAAAGTGG + Intergenic
918493243 1:185105666-185105688 CAGAAGGAGAGGAGGGAAAGGGG + Intergenic
919085058 1:192911482-192911504 CTGAGGGAGTGATGAGAATGAGG + Intergenic
919275744 1:195414237-195414259 CTCAAGAATTGTTGGGAAAAAGG - Intergenic
920438960 1:205965804-205965826 GTGGAGGGCTGTTGGGAAAGGGG + Intergenic
922373304 1:224933465-224933487 CTGAATGAGAGTGGTGAAAGGGG + Intronic
922677232 1:227560581-227560603 TTGAAGGCGTTTTGAGAAAGAGG + Intergenic
923842173 1:237684820-237684842 CTGAAGGAGAGTAGAGAAAGAGG + Intronic
924830650 1:247591011-247591033 CTGAAGGCTTCCTGGGAAAGTGG + Intergenic
1063614252 10:7588644-7588666 ATGAAGAAGTGCTGGGAAAGTGG - Intronic
1063853640 10:10222160-10222182 CTGAAAGGGTGTGGGGGAAGAGG - Intergenic
1065099182 10:22316684-22316706 CGGACGGAGTGTTGGGGACGTGG + Intronic
1065958417 10:30713543-30713565 ATGAAGGAGGGTTGAGGAAGAGG + Intergenic
1066796972 10:39133009-39133031 CTTAAGGAGTATGGGGAAAATGG + Intergenic
1067219431 10:44333217-44333239 CTAAAGAAGTGTTGGAGAAGTGG + Intergenic
1068120003 10:52775327-52775349 TGGAAGCAGTGTTAGGAAAGTGG - Intergenic
1068726052 10:60304817-60304839 ATGAAGCAGGGGTGGGAAAGAGG - Intronic
1069231566 10:66015451-66015473 ATGAAGGAGTGTGGGGAATGTGG - Intronic
1069667642 10:70174163-70174185 CAGAAGGAGTGGTAGGAAATGGG + Intergenic
1069735864 10:70653768-70653790 CTAAAGGAGTGTGAGGAATGGGG + Intergenic
1071112495 10:82176302-82176324 CTGAGAAAGAGTTGGGAAAGAGG - Intronic
1071845542 10:89517777-89517799 TTGAAGGATTGTTGAGATAGTGG - Intronic
1072767663 10:98108753-98108775 CTGAAGGAGTCTTTGGGGAGTGG + Intergenic
1072792002 10:98324846-98324868 ATGAAGAAGTGTTAGGAAACTGG + Intergenic
1073026595 10:100491770-100491792 ATGCAACAGTGTTGGGAAAGTGG + Intronic
1073480110 10:103781037-103781059 CTGCAGGAGTGATGGGGAGGAGG - Intronic
1074346448 10:112690909-112690931 CTGAAGGAGGGCTGGGGCAGGGG - Intronic
1074740213 10:116479219-116479241 CTGAAGTGCTGTTGGGACAGTGG + Intergenic
1076225503 10:128771635-128771657 CTGGAGGAGTGGTGGGAAGGGGG + Intergenic
1077927641 11:6697796-6697818 CTGGAGGAGTGAATGGAAAGGGG + Intergenic
1077985578 11:7347992-7348014 CTGGAGGAGTGAGGGGAAGGGGG + Intronic
1078354658 11:10624834-10624856 CTGCAGGAGTGTAGGGAGTGAGG + Intronic
1081067117 11:38557610-38557632 CTGAAAGACTGTGAGGAAAGTGG - Intergenic
1081594124 11:44447439-44447461 CTGAAGGGCTGATGGGAAACAGG + Intergenic
1081626090 11:44656071-44656093 CTGCAGAAGTGTTGGGTGAGGGG - Intergenic
1081685919 11:45042937-45042959 CTGAGGGAGTGTGGGGCATGCGG - Intergenic
1084456738 11:69272157-69272179 TTGAAGGAGTGATGGGTAACTGG - Intergenic
1085151336 11:74254799-74254821 CTGAAGGGCTATAGGGAAAGGGG - Intronic
1085363043 11:75909942-75909964 CTGAAGGAGTTTGTGTAAAGTGG + Intronic
1085378942 11:76094981-76095003 TGGAAGCAGAGTTGGGAAAGAGG + Intronic
1085740470 11:79074358-79074380 CAGAAGGAATGCTGGGGAAGGGG + Intronic
1086854756 11:91852716-91852738 CTGAGGGAGACTTGGGCAAGTGG - Intergenic
1089392704 11:118113015-118113037 CTCAAGGAGGGCTGGGGAAGGGG - Intronic
1090399812 11:126441858-126441880 CTGAAGGATTTTTAGGAAGGAGG - Intronic
1090461929 11:126898916-126898938 TTGGAGGACAGTTGGGAAAGGGG - Intronic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091584626 12:1809143-1809165 CGGAAGGAGACTTGGGAAAGAGG - Intronic
1095269253 12:40197144-40197166 ATTAATGTGTGTTGGGAAAGAGG - Intronic
1096169085 12:49452189-49452211 CAGAAGAAGTGATGTGAAAGAGG - Intronic
1096185427 12:49577355-49577377 CTGGAGGAGTGTGGGGAACGTGG + Intronic
1097100914 12:56588761-56588783 CTGTAGGAAGGTTGGGGAAGTGG + Intronic
1097386580 12:58957062-58957084 CTGAGGGAGCATTGAGAAAGGGG - Intergenic
1098008981 12:66030490-66030512 CTGAGGGAGTGTTCAGAAATAGG + Intergenic
1098119714 12:67223065-67223087 GTGAAGGAATGAGGGGAAAGAGG + Intergenic
1100509628 12:95256424-95256446 CTGAAAAAGTATTGGAAAAGAGG - Intronic
1101443885 12:104723471-104723493 CGGAGTGAGTGTCGGGAAAGGGG - Intronic
1101587839 12:106100473-106100495 CTGAAGGACTTTTGAGTAAGTGG - Intronic
1102608433 12:114089368-114089390 GAGAAGCAGTGTTGGCAAAGGGG - Intergenic
1106071938 13:26420817-26420839 GAAAAGGTGTGTTGGGAAAGAGG - Intergenic
1106329798 13:28729566-28729588 CTTAAGAAGTTTTGAGAAAGAGG + Intergenic
1106582694 13:31031652-31031674 CTGAATGAATGTTGGCTAAGTGG - Intergenic
1109374944 13:61480291-61480313 CTGAAGGAGCATTTGGACAGAGG + Intergenic
1109595918 13:64553170-64553192 ATGAAAGAGTTTCGGGAAAGGGG + Intergenic
1112447983 13:99483989-99484011 CTGAAGGTGGGTGTGGAAAGGGG - Intergenic
1112524759 13:100134335-100134357 CTGAAGCAGTTTTGGAAAAATGG - Intronic
1112722438 13:102259972-102259994 CTGAAAGGGTGTCGGGAACGTGG - Intronic
1113583637 13:111448012-111448034 CTGAAGGAGTGGTGTTTAAGGGG + Intergenic
1115477042 14:33825663-33825685 CTGAAGCAGGGCAGGGAAAGGGG + Intergenic
1118712956 14:68537605-68537627 CTAAGGGATTGTTGGAAAAGAGG + Intronic
1119790024 14:77341752-77341774 CTGAAGGACTGCTGGGACAGGGG - Exonic
1120333256 14:83120718-83120740 CAGAAGGCATGTTGGGAAAATGG - Intergenic
1121602119 14:95213185-95213207 ATGAAGTAGTGTGGGGAGAGGGG + Intronic
1121688778 14:95859464-95859486 CTGAAGGAGTCTTGGAAAACAGG - Intergenic
1121823523 14:96991275-96991297 CTGTAGGAGTCTTGGGGCAGTGG + Intergenic
1121892279 14:97605366-97605388 GTGCAGGAGAGGTGGGAAAGTGG - Intergenic
1123726905 15:23112277-23112299 CTGGAGCAGTGGTGGGAACGTGG + Intergenic
1124638959 15:31383126-31383148 CACAAGGTGTTTTGGGAAAGTGG + Intronic
1125315717 15:38429076-38429098 CTGAAGTAGGATTAGGAAAGTGG - Intergenic
1125388295 15:39163119-39163141 CTGAAGGAGTAGAGAGAAAGAGG - Intergenic
1125607761 15:40951689-40951711 CTGAAGGAGTATTGGGTCAAAGG + Intergenic
1125875124 15:43137618-43137640 CTGTGGGAGGGTTGGGACAGTGG - Intronic
1127133228 15:55890353-55890375 CTGAAGGAGGGGTGGGGAAATGG - Intronic
1127385574 15:58463743-58463765 CTAAGGGAGTGATGGAAAAGTGG - Intronic
1127505211 15:59591356-59591378 CTAAACGAGTGTGGAGAAAGGGG + Intergenic
1128526429 15:68415333-68415355 CTGATGGAGTCTAGAGAAAGGGG + Intronic
1129325503 15:74798413-74798435 CTGACTGAGTGCTGGGAAAAAGG - Intronic
1129778362 15:78252116-78252138 CTGAGGGCCTGTTGAGAAAGAGG + Intergenic
1129821008 15:78602028-78602050 CTCAAGGACTATTGGGAGAGCGG - Exonic
1129882670 15:79017459-79017481 CTGCAGGATAGTGGGGAAAGGGG + Intronic
1130224774 15:82047884-82047906 CTGGAGCTGTCTTGGGAAAGAGG + Intergenic
1132538683 16:497006-497028 CTGAAGGAGTGTTGGGAAAGGGG + Intronic
1133852181 16:9515922-9515944 ATGCAGCAGTGTTGAGAAAGAGG - Intergenic
1137536135 16:49327658-49327680 CTGAAGAGCTGTTGGGGAAGTGG + Intergenic
1137707004 16:50542477-50542499 CTCAAGGAGTGAAGGAAAAGTGG - Intergenic
1138135295 16:54516170-54516192 GTGAAGGTGTGTAGAGAAAGAGG + Intergenic
1138562902 16:57812612-57812634 CTGAAGGAATGTGGGGAGGGTGG + Intronic
1139065615 16:63310006-63310028 CCGAAGGGGTGGTGGGAAAGGGG - Intergenic
1139666211 16:68458501-68458523 CTGCAGGAGTGTAGGATAAGAGG - Intergenic
1139939730 16:70596562-70596584 CTGAGGCAGTGGTGGGAAATGGG - Intronic
1140324107 16:73983519-73983541 CAGAAGGAGAGTTGTGAGAGAGG + Intergenic
1140975248 16:80053718-80053740 CTTAAGGAATGTCGTGAAAGAGG - Intergenic
1141124125 16:81388193-81388215 CTGGAAGAGGGTTGGGACAGAGG - Exonic
1141544548 16:84756099-84756121 CTGAAGGGGTGTTGGGAGATGGG - Intronic
1141608210 16:85167637-85167659 CTGAAGGAATGTTGGGAGCGGGG - Intergenic
1141611958 16:85186953-85186975 CTGAGGGGCTGGTGGGAAAGAGG - Intergenic
1142155405 16:88530690-88530712 CTGCAGGGGTGTGGGGAGAGGGG - Intronic
1143295623 17:5869713-5869735 CTGAAGAACTTATGGGAAAGCGG - Intronic
1144795148 17:17886344-17886366 CAGAAGGAGTGTTGGCCAAGAGG - Intronic
1145310766 17:21700069-21700091 CTGAGGCTGTGCTGGGAAAGGGG - Intronic
1145445271 17:23164736-23164758 CAGAAAGAGTGTTTGGAAACTGG - Intergenic
1145734472 17:27217680-27217702 CTAAAAGCGTGTTGGGGAAGAGG + Intergenic
1146638428 17:34522800-34522822 TTGGAGGAGTGTTGGAAGAGAGG + Intergenic
1147134432 17:38427067-38427089 CTGAAAAAGTCATGGGAAAGAGG + Intergenic
1147400229 17:40176651-40176673 CAGAAGGAGTGTGGGGGAGGAGG - Intergenic
1149220228 17:54408482-54408504 GTGAAGGAGTGTTGGGACTGTGG - Intergenic
1149660846 17:58333258-58333280 TTGGAGGAGTGGCGGGAAAGAGG + Intergenic
1149730819 17:58944483-58944505 CTGGAGGGGTGGTGGGAATGAGG - Intronic
1149734655 17:58981317-58981339 CTGAAGGGATGGTGGGAAGGGGG - Exonic
1150629954 17:66872947-66872969 CTCAAAGAGTGTTGGGAAGAAGG - Intronic
1150963327 17:69938735-69938757 CTGAAGGTTTTTTGGGGAAGAGG + Intergenic
1151215672 17:72575052-72575074 CTGGAGGAGTGTTGGGCCATGGG - Intergenic
1151903828 17:77035038-77035060 CTGAGGGAGGGTTTGCAAAGGGG - Intergenic
1153816420 18:8794279-8794301 ATGAAGGAGTATTGCGGAAGAGG + Intronic
1154092680 18:11379685-11379707 TTGAAGGAGTTTTGTGAATGAGG - Intergenic
1154096704 18:11423584-11423606 CACAAGGAGTGTTGAAAAAGTGG - Intergenic
1154131457 18:11740007-11740029 CGGAAGGAGGGCTGGGACAGGGG - Intronic
1155015613 18:21835846-21835868 CACGAGGAGTATTGGGAAAGAGG + Intronic
1155500473 18:26482396-26482418 CCTAAGGAGGGATGGGAAAGAGG + Intronic
1156451128 18:37266968-37266990 CAGAAGGGCTGTGGGGAAAGGGG + Intronic
1156920814 18:42520653-42520675 CTCAATGAGTGTTTGGAAGGTGG - Intergenic
1158081875 18:53602082-53602104 CTGAACCAGAGTGGGGAAAGTGG - Intergenic
1158284349 18:55862911-55862933 CTGAAGGTGTGTGGCAAAAGAGG + Intergenic
1158342098 18:56477651-56477673 CTGATGGAGTGATAAGAAAGAGG + Intergenic
1160690779 19:460113-460135 GGGAAGGGGTGTTTGGAAAGGGG - Intronic
1161263122 19:3348525-3348547 CTGCAGAAGTGTGGAGAAAGAGG + Intergenic
1162536159 19:11263761-11263783 CTGCAGCAGTGCTGGGAGAGAGG - Intergenic
1162986323 19:14272470-14272492 CTGAAGGAATGTGGGGGCAGGGG + Intergenic
1163835523 19:19571174-19571196 CTCAAGAAGTGCTGGGGAAGAGG + Intronic
1165310681 19:35027818-35027840 CTGGAGGAGGGTTTGGAGAGTGG + Intergenic
1167467782 19:49659203-49659225 CTGGAGGGGTCTTGGTAAAGGGG - Intergenic
1168065001 19:53914339-53914361 CTCCAGGGGTGTTGGGAAAGCGG - Intronic
1168421440 19:56206671-56206693 CTGATGGAATGTAGGGAAGGAGG + Intronic
1168424021 19:56224272-56224294 CTGATGGAATGTAGGGAAGGAGG - Intronic
1168426695 19:56244800-56244822 CTGATGGAATGTAGGGAAGGAGG + Intronic
925387443 2:3472040-3472062 CTGCAGGAGTGGTGGGAAGTTGG + Intronic
926438703 2:12863990-12864012 ATGAAGGAGAGTTGGTAAACAGG - Intergenic
927667116 2:25040689-25040711 CTGCAGGACTGTTGGGAAACTGG - Intergenic
927782638 2:25951918-25951940 ATGAAGGAGTGATGGGAAAATGG + Intronic
928064814 2:28152539-28152561 GTGAAGGTGTCTTGGGTAAGTGG + Intronic
928948511 2:36793109-36793131 CTCAGTGAGTGTTGGGGAAGTGG - Intronic
929134651 2:38611947-38611969 CTGTAGGAGTCTTGGCAAATTGG + Intergenic
929733994 2:44526147-44526169 CTTAAGAAATCTTGGGAAAGAGG - Intronic
929796066 2:45059134-45059156 CTGAAGGAGAGTATGGAAACTGG - Intergenic
929889062 2:45904753-45904775 CAGCAAGAGTCTTGGGAAAGAGG - Intronic
930095091 2:47560831-47560853 ATGATGGAGAGTTTGGAAAGGGG + Intronic
931253432 2:60552070-60552092 CTGAAGGGGTTTGGGGGAAGAGG + Intronic
931464066 2:62471644-62471666 CTGAAGGAGTGCTGGGGAGGGGG + Intergenic
931624560 2:64245181-64245203 CTGAAGGGAAGTTGGGGAAGCGG - Intergenic
931752926 2:65346786-65346808 CTGAAGAAGGGTTGTGAGAGGGG - Intronic
933243364 2:79947843-79947865 CTAAAAGAGTGTTATGAAAGAGG + Intronic
933824584 2:86147467-86147489 TTTAAGGAGAGTTGGTAAAGGGG - Intronic
935092836 2:99912993-99913015 CTGATGGAGTGTGGGGTTAGTGG - Intronic
935294525 2:101637557-101637579 GTGAAGGAGTGTTGGGATTTGGG + Intergenic
935878670 2:107538959-107538981 CTGCTGGAGAGTTGGGAGAGGGG + Intergenic
936595606 2:113844562-113844584 CTGAAGAAGTGAGGGTAAAGGGG + Intergenic
936685413 2:114821527-114821549 TTGTGGGACTGTTGGGAAAGTGG - Intronic
940221417 2:151355731-151355753 CTGCATGAGAGTTGGGAGAGGGG + Intergenic
940692822 2:156940850-156940872 CTGCAGGGATGTTGAGAAAGAGG - Intergenic
940959934 2:159773976-159773998 CTGAAGAAATGTTGAGAAAATGG - Intronic
941415671 2:165217993-165218015 GTCAGGGAGTGTGGGGAAAGTGG - Intergenic
941961755 2:171260881-171260903 GTGGAGGAGTGAGGGGAAAGAGG + Intergenic
942283727 2:174392654-174392676 ATAAAGGAGTGATGGGAAAAGGG + Intronic
942414425 2:175743984-175744006 TTGGAGAAGTATTGGGAAAGAGG + Intergenic
943474911 2:188341971-188341993 CTAAAGGAGTGTATAGAAAGAGG - Intronic
943799005 2:192034397-192034419 ATGGAGGAGTGATGGGAGAGTGG - Intronic
944100867 2:196025377-196025399 CTGAAAGATTGTAGGGAAGGGGG - Intronic
944273572 2:197809655-197809677 CTGCAGGGGTATGGGGAAAGTGG - Intronic
945824463 2:214703716-214703738 TTGAATAAGTGTTGTGAAAGTGG - Intergenic
947139967 2:227011660-227011682 GGGAAGTGGTGTTGGGAAAGGGG - Intronic
947406451 2:229782296-229782318 CTGTAGAAGTGTTGGGAGAAGGG - Intronic
947520143 2:230839116-230839138 CCCAAGGACTGTTGGGCAAGAGG + Intergenic
947877145 2:233475120-233475142 CTGAAGCAGGCTTGGGAAAAAGG + Intergenic
948552245 2:238781220-238781242 CTGAAGGAGAGGAGAGAAAGTGG - Intergenic
1169050401 20:2572205-2572227 ATGAAGGTGCCTTGGGAAAGGGG + Exonic
1171307701 20:24120209-24120231 CTGAAGGAGGGCAGGGAATGGGG + Intergenic
1172104713 20:32510050-32510072 CTGCAGGAGTGTCGGTAATGAGG - Intronic
1172300392 20:33845677-33845699 CTGGAGGGGAGTTGAGAAAGGGG + Intronic
1172641999 20:36446137-36446159 CAGAATGGATGTTGGGAAAGGGG - Intronic
1172775022 20:37402317-37402339 CTGAAGAAGTGTGGGGAGGGTGG + Intronic
1173216856 20:41093433-41093455 GGGAAGGATGGTTGGGAAAGGGG - Intronic
1173744975 20:45429259-45429281 CTGAAGTGCTATTGGGAAAGAGG - Intergenic
1173898095 20:46566176-46566198 CTGAATGTGTGTTGGGGGAGGGG + Intronic
1174458914 20:50669224-50669246 CTGAACCAGGGTTGGGTAAGGGG - Intronic
1174511257 20:51054648-51054670 CAGAAGCAGTGATGGAAAAGGGG + Intergenic
1174854365 20:54028865-54028887 CGGAAAGAATCTTGGGAAAGAGG - Exonic
1175332067 20:58172022-58172044 CTGAAGGATGGTTGGGGAGGTGG - Intergenic
1175782386 20:61690799-61690821 CTGAAGGAGACAAGGGAAAGTGG + Intronic
1176589034 21:8622444-8622466 GAGAAGGAGTTTTGGGAAATAGG - Intergenic
1179005236 21:37508080-37508102 CTGATTCAGTGTGGGGAAAGAGG - Intronic
1180271858 22:10599441-10599463 GAGAAGGAGTTTTGGGAAATAGG - Intergenic
1180818639 22:18809517-18809539 TGGCAGGAGTGATGGGAAAGGGG + Intergenic
1181016984 22:20076313-20076335 CTGAAGGGGTTTGAGGAAAGGGG + Intergenic
1181204862 22:21243972-21243994 TGGCAGGAGTGATGGGAAAGGGG + Intergenic
1183061594 22:35339582-35339604 CTGCAGGAGTGTGGGCAGAGAGG + Intronic
1183261509 22:36798625-36798647 CTGAAGTGGGGTTGGGGAAGAGG - Intergenic
1184390064 22:44198695-44198717 CTGCAGGAGAGTTGGGAGTGAGG - Exonic
1203222063 22_KI270731v1_random:51443-51465 TGGCAGGAGTGATGGGAAAGGGG - Intergenic
1203268768 22_KI270734v1_random:35370-35392 TGGCAGGAGTGATGGGAAAGGGG + Intergenic
949743703 3:7264493-7264515 CTGAATGACTGTTGGGGAAAGGG - Intronic
950526649 3:13528362-13528384 CTGAAGTAGGGGTGGGAAAGAGG + Intergenic
950671884 3:14532249-14532271 CTGGAGCAGAGTGGGGAAAGTGG - Intronic
952498872 3:33940550-33940572 CAGAAGGAGTGTTAGGGTAGAGG + Intergenic
952857518 3:37784433-37784455 CTGATGGAGAGATGGGGAAGGGG - Intronic
953027135 3:39151794-39151816 CTGAAGGAGAGCTGGGGGAGGGG + Intronic
954751595 3:52817188-52817210 GTGAAGGAGTGCTGAGAAAGGGG - Intronic
956223915 3:66934697-66934719 CTTAAGGAGTGAGGGGAAAATGG - Intergenic
957225625 3:77441616-77441638 CTGAAGGACAGCTGGGACAGAGG + Intronic
957314475 3:78559694-78559716 ATGCAGGAGTGTTGGGAGATGGG + Intergenic
957746996 3:84358261-84358283 CTGAATGAGAGTGGTGAAAGTGG + Intergenic
960311773 3:116125520-116125542 TTGAGAGAGTGTTGGAAAAGGGG - Intronic
961134340 3:124496056-124496078 CTGGAGGAGTTTTGGGGAAGGGG + Intronic
961430453 3:126878713-126878735 ATGAAAGATTGTTGGGAAATAGG + Intronic
962259100 3:133891931-133891953 CTGGAAGAGTCTTGGGGAAGGGG + Intronic
964835135 3:160929863-160929885 CTGAAGGAGAGGTGGGAAGGTGG - Intronic
965430601 3:168582932-168582954 ATGAAGGAGTGCAGGGGAAGTGG - Intergenic
966288531 3:178326686-178326708 CTGAAGGAAGGGTGGGAAATAGG - Intergenic
966591814 3:181692580-181692602 CTGAAGGTATGTTTGGGAAGAGG - Intergenic
968534058 4:1112910-1112932 CTGCGGGAGGGTGGGGAAAGAGG - Intronic
969698392 4:8748831-8748853 CTAAAGGAGACTGGGGAAAGAGG + Intergenic
970147389 4:13051215-13051237 CTGAAGGAGAGGTGGGAAGTGGG + Intergenic
970460761 4:16272559-16272581 CAGAAGGAGTCCTGGGAGAGAGG - Intergenic
971619640 4:28839466-28839488 CTGAAGGATTTTTAGGAAAGTGG + Intergenic
971704520 4:30023202-30023224 GTGAAGGAGTTTTGGGGATGAGG - Intergenic
975099530 4:70496808-70496830 ATGAAGGAGTTATGGGAAAAGGG - Intergenic
976618978 4:87108503-87108525 ATAAAGGAGAGTTGGGAGAGAGG + Intronic
976879075 4:89896399-89896421 TTAAAGGAGTGTTGTTAAAGAGG + Intronic
977643406 4:99383372-99383394 AGGAATGAGTGTTAGGAAAGAGG - Intergenic
978571174 4:110139717-110139739 CTGAAGTGGACTTGGGAAAGGGG - Intronic
978826873 4:113035188-113035210 CTGCAGGTGGGTTGGGAAGGGGG + Intronic
981148514 4:141353870-141353892 GAGAAGGAGTATTGGTAAAGAGG - Intergenic
981313481 4:143318751-143318773 CTAAAGAATTATTGGGAAAGGGG + Intergenic
981940933 4:150280917-150280939 GTGCAGGAGTGCTGGGAAAAAGG + Intronic
981977449 4:150748024-150748046 CTGAGGTAGTGATGGGGAAGAGG - Intronic
982037444 4:151360026-151360048 CAAAAGGAGGGTTGGAAAAGAGG + Intergenic
982722138 4:158869868-158869890 CTGATGGAGTGTTAAGAAAGAGG - Intronic
983247757 4:165308403-165308425 CTGAAGGAGGGAGAGGAAAGAGG - Intronic
987061347 5:14246885-14246907 CTGAAGGGGAGTTGTGAAGGTGG - Intronic
987939669 5:24517389-24517411 CTGAAGAATTGAAGGGAAAGTGG + Intronic
988662336 5:33285525-33285547 ATGCAGCTGTGTTGGGAAAGGGG + Intergenic
990530351 5:56667214-56667236 CTGAAGGATAGTGGGTAAAGGGG + Intergenic
992578040 5:78139901-78139923 CAGAAAGAGTTTTGGGGAAGGGG + Intronic
993607186 5:90006208-90006230 AGGAAGGAGTGGTGGGAAGGTGG + Intergenic
994222443 5:97211482-97211504 CTGTAGGAGTGGGGGGAATGGGG - Intergenic
994738234 5:103584995-103585017 CTGCAGGATTGTTGTGAAATTGG - Intergenic
996787259 5:127253275-127253297 ATGAAGGAGTGTTTAGATAGGGG + Intergenic
997863202 5:137438252-137438274 CTCAAGGAGAGATGGGAAACTGG + Intronic
999261752 5:150242777-150242799 CGGAAGGAGTGTGGGGAGAATGG - Intronic
999488586 5:152025982-152026004 CAGAAGGAGGCTTTGGAAAGTGG - Intergenic
999885054 5:155913140-155913162 CTCAAGGAGGCTTAGGAAAGAGG + Intronic
999997303 5:157104522-157104544 CTGAAATAGTGTTTGAAAAGAGG - Intronic
1000161600 5:158602882-158602904 TTGAAGGTGTGGTGGGACAGAGG - Intergenic
1000208792 5:159091036-159091058 ATGAAGGAGTGTTTGGACATTGG - Intronic
1000247216 5:159458652-159458674 CTGGTGGGGTGTGGGGAAAGGGG - Intergenic
1002367577 5:178725251-178725273 CTCAAGAAGTGATGGGGAAGCGG - Intronic
1002385918 5:178867177-178867199 CTCAAGAAGTGGTGGGGAAGCGG + Intronic
1002473473 5:179451229-179451251 CAGAAGCAGTGATGGGAGAGTGG + Intergenic
1002535261 5:179872391-179872413 CTGCAGGAGGGCTGGGAATGTGG + Intronic
1002827448 6:786068-786090 CTGAAGCCGTGTTGGGGAGGCGG + Intergenic
1002827463 6:786124-786146 CTGAAGCCGTGTTGGGGAGGCGG + Intergenic
1002827480 6:786180-786202 CTGAAGCCGTGTTGGGGAGGCGG + Intergenic
1003063733 6:2884063-2884085 AAGAAGGTGTGTTGGGAAGGTGG + Intergenic
1004123085 6:12844794-12844816 CTAAAGAAATGATGGGAAAGTGG + Intronic
1005992978 6:30914817-30914839 CATCAGGAGTGTTTGGAAAGGGG - Exonic
1006710538 6:36065433-36065455 ATGAAGGAGAGTTGGAAAGGTGG + Intronic
1007993380 6:46280790-46280812 CTGAAGGAGTCTTAGTAGAGTGG + Intronic
1008020527 6:46572757-46572779 CAGAAGGAGGATTGAGAAAGGGG - Intronic
1009864285 6:69377085-69377107 CTTAAAGTGTGTTGTGAAAGGGG - Intronic
1011272274 6:85592143-85592165 CTGTAGGAGTGTGGGAGAAGTGG - Intronic
1013302548 6:108818131-108818153 AGGAAGGAGGGTTTGGAAAGTGG - Intergenic
1013693535 6:112673570-112673592 CTGGAGAAGTGTTGGCAAAGAGG + Intergenic
1014595486 6:123332518-123332540 CTGAAGATGTGTTTGGAAGGTGG - Intronic
1015871254 6:137778690-137778712 CTGAAGGCCTGTTGGTAAAGGGG - Intergenic
1016162580 6:140899514-140899536 CTGAAGGAGTTTCAGGACAGAGG - Intergenic
1017408696 6:154147066-154147088 CTGAGGGAGAGGTGGGGAAGGGG + Intronic
1017726139 6:157277088-157277110 CTGTGGGAGAGTTGAGAAAGAGG + Intergenic
1019059224 6:169243217-169243239 CAGAGGGAGTGGTGGGAATGTGG - Intronic
1019135512 6:169905236-169905258 CTGAAGGAGTGTGGGGCACGGGG + Intergenic
1019516063 7:1440714-1440736 AGGAAGGAGTGCTGGGAATGGGG + Intronic
1019855083 7:3597374-3597396 CTGAAAGAGTGATGTGAAAATGG - Intronic
1020056195 7:5118865-5118887 CTTCAGGAGTCTTGGGAAAGAGG + Intergenic
1021862280 7:24917956-24917978 CTGAAGGAATCTTGGTAAATGGG - Intronic
1022344982 7:29505724-29505746 CTGAAGAAGTGTGGAGAATGTGG - Intronic
1022425999 7:30269353-30269375 CTGAAGGAGAGATGGTAAAGAGG - Intergenic
1022838927 7:34144148-34144170 CTGAAGGAGTGAAGGGAGTGAGG + Intronic
1022840038 7:34155413-34155435 ATGATTAAGTGTTGGGAAAGAGG - Exonic
1023209254 7:37785396-37785418 CTGAAGTATTTTTAGGAAAGTGG - Intronic
1024244200 7:47457091-47457113 CTGGAGGTGTGCTGGTAAAGGGG + Intronic
1024824082 7:53368540-53368562 CTGAGGTAGGCTTGGGAAAGAGG - Intergenic
1025264633 7:57446244-57446266 CTGAAACAGTCTTGGCAAAGTGG + Intergenic
1027814637 7:82953253-82953275 TTGTTGGAGTGTGGGGAAAGTGG + Exonic
1030660593 7:112214692-112214714 GTGAAGGGAGGTTGGGAAAGAGG + Intronic
1030672104 7:112349179-112349201 CCTGAGGAGTGTTGGAAAAGGGG + Intergenic
1030724537 7:112910491-112910513 TTGAAAGACTGTTAGGAAAGAGG + Intronic
1031960100 7:127981426-127981448 CTGGAGGTGTGTTTGGGAAGGGG - Intronic
1032508675 7:132454946-132454968 CTGAAGGAGCTGTGGGAAGGTGG - Intronic
1034200204 7:149279403-149279425 CTGCAGGAGTGTTGGGGACATGG + Intronic
1034299005 7:149998890-149998912 CTGAGGGAGTGGTGGGAGGGAGG - Intergenic
1034807011 7:154097883-154097905 CTGAGGGAGTGGTGGGAGGGAGG + Intronic
1035679800 8:1479501-1479523 CTGAAAGGGGGTGGGGAAAGTGG + Intergenic
1036579617 8:10061896-10061918 CTGCAGCAGTGGTGGGGAAGAGG + Intronic
1038425928 8:27463757-27463779 CTGAAGGACTACTGGGAGAGCGG - Exonic
1038709354 8:29927282-29927304 CTGAAGGGGTGAAGGGACAGAGG - Intergenic
1039555550 8:38472439-38472461 CAGAAGGAATGTGGGGAGAGGGG - Intergenic
1041157679 8:55004975-55004997 CTAACGCAGTGTTGGGAAAAAGG - Intergenic
1041388739 8:57330499-57330521 GTGAAGGAGAGTTGGGAAGGAGG - Intergenic
1041964535 8:63659689-63659711 CTGAAGAAGTGTTTGGAATTTGG + Intergenic
1042193389 8:66210855-66210877 CTGGAGGAGATTTGGGGAAGGGG - Intergenic
1044194383 8:89356816-89356838 CTGCAGGTGTTTAGGGAAAGTGG - Intergenic
1044643996 8:94418625-94418647 CTGCAGGGGTTTTGGGTAAGGGG - Intronic
1044895696 8:96889297-96889319 TTGAAATAGTGTTGGAAAAGAGG + Intronic
1046100612 8:109610088-109610110 CTTAAGGAGGGTTGGGGATGGGG - Intronic
1046714933 8:117557157-117557179 CTGAAGACATGATGGGAAAGGGG - Intergenic
1047397932 8:124519879-124519901 CTGAAGCAGTGCTGCGTAAGGGG + Intronic
1048534444 8:135279668-135279690 CTGAAGGAGTTTAGAGAAAGGGG + Intergenic
1048567526 8:135618278-135618300 CTGGAGGAGTTCTGGGAAGGAGG + Intronic
1049508534 8:143016317-143016339 CTGCAGTATTGCTGGGAAAGAGG + Intergenic
1050056472 9:1660625-1660647 CCCAAGGAGTGTTGTCAAAGGGG + Intergenic
1051818325 9:21135239-21135261 CTCAAGGAGTGTGAGGAAATAGG - Intergenic
1051897798 9:22006419-22006441 CTGAAGGTGGGGTGGGAAAGTGG - Intronic
1053086152 9:35224669-35224691 TTGAATGAGAGTTGTGAAAGTGG + Intronic
1054823949 9:69552070-69552092 CTGCAGAAGTGTTGGGAATATGG + Intronic
1055321561 9:75088116-75088138 CAGGAGGAGCGTGGGGAAAGGGG - Exonic
1055501019 9:76902291-76902313 TTGAAGGAGTGTAGGGAATGAGG - Intronic
1056597200 9:88017260-88017282 GAGGAGGAGTGTTGGGAAAGAGG - Intergenic
1057035957 9:91811727-91811749 CTGAGGGAGTGCAGGGAAACAGG - Intronic
1057213073 9:93211405-93211427 GTGAATGAGTGGTGGGTAAGTGG - Intronic
1057970053 9:99546207-99546229 GTGGAGGAGTGGGGGGAAAGTGG - Intergenic
1058637913 9:107054805-107054827 CTGATGAAGTGTTGGGAAGAGGG - Intergenic
1058858850 9:109094573-109094595 CTGAAGGACTGTTTGGGCAGAGG - Intronic
1059553791 9:115257728-115257750 CTGAAGGAGGGTGGTGATAGAGG + Intronic
1059734966 9:117091651-117091673 ATGCAGGAGTGCTGGGGAAGAGG + Intronic
1059749154 9:117231648-117231670 TTTAAGGAGAGTTTGGAAAGGGG + Intronic
1059800145 9:117741936-117741958 CTGAAAGAGTAATGGGACAGTGG - Intergenic
1060426764 9:123512722-123512744 CTGAAGGTGACTTGGGACAGTGG + Intronic
1060509811 9:124223616-124223638 CTGGAAGAGGGTGGGGAAAGTGG + Intergenic
1060720674 9:125974844-125974866 TTGCAGGAGTCTTGGGGAAGGGG + Intergenic
1062166576 9:135110760-135110782 CTGAATGGGTGGTGGGAAAGAGG - Intronic
1186378704 X:9034271-9034293 CTGAAAGATTGTGGGGACAGAGG - Intronic
1189096326 X:38144098-38144120 CTGGAAGAGAGTTGGGCAAGGGG - Intronic
1190305386 X:49079004-49079026 CTGAAGGAGTTTGGGGAAGCCGG - Intronic
1190439475 X:50463196-50463218 GAGAAGGAGGGGTGGGAAAGAGG - Intronic
1192452753 X:71253850-71253872 CTGGAGGAGCAATGGGAAAGGGG - Intronic
1192631284 X:72779768-72779790 CGTAAGGAGTGATGGGCAAGGGG + Intronic
1192650425 X:72941033-72941055 CGTAAGGAGTGATGGGCAAGGGG - Intronic
1193036601 X:76957984-76958006 GTGAATGTGTGTTGGCAAAGTGG + Intergenic
1193667575 X:84341154-84341176 CTGAAGGAGAGTGGGGAAGTAGG - Intronic
1195732857 X:107982831-107982853 TGGGAGGAGTGTGGGGAAAGAGG - Intergenic
1195884786 X:109626479-109626501 CTGAAGAACGGTTGGGGAAGAGG - Intronic
1197186480 X:123592866-123592888 CTGAATGTGTGTTGGGGAAGAGG + Intergenic
1198992588 X:142532379-142532401 CTAAATGCGTGTTGGGAATGAGG - Intergenic
1199142570 X:144331084-144331106 CAGAAGGAGTGTTGGGGATGTGG + Intergenic
1201349591 Y:13024489-13024511 CTGAATGGTGGTTGGGAAAGGGG - Intergenic
1201968838 Y:19769300-19769322 ATTAAGGAGTGCTGAGAAAGTGG + Intergenic