ID: 1132539288

View in Genome Browser
Species Human (GRCh38)
Location 16:500907-500929
Sequence CTGGGTTGCAGCTTCATGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 221}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132539279_1132539288 29 Left 1132539279 16:500855-500877 CCTCTAGGACAGCTCAGAAGTGC 0: 1
1: 0
2: 1
3: 5
4: 84
Right 1132539288 16:500907-500929 CTGGGTTGCAGCTTCATGCCTGG 0: 1
1: 0
2: 0
3: 18
4: 221
1132539287_1132539288 -7 Left 1132539287 16:500891-500913 CCTCTCAGGATGGGCTCTGGGTT 0: 1
1: 0
2: 1
3: 19
4: 237
Right 1132539288 16:500907-500929 CTGGGTTGCAGCTTCATGCCTGG 0: 1
1: 0
2: 0
3: 18
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132539288 Original CRISPR CTGGGTTGCAGCTTCATGCC TGG Intronic
900926120 1:5707214-5707236 CAGAGCTCCAGCTTCATGCCTGG - Intergenic
901739200 1:11331108-11331130 CTGGCTTCCAGCTCCAAGCCCGG - Intergenic
902047043 1:13532642-13532664 CAGGCATGCACCTTCATGCCCGG + Intergenic
902577995 1:17390459-17390481 CTGGGGTGCACCACCATGCCTGG - Intronic
902862129 1:19253989-19254011 CTGGGGTGCAGATACATACCAGG + Intronic
903862303 1:26372117-26372139 CTGGGGTGCAGATTGATGGCTGG - Intronic
904793455 1:33041039-33041061 CTGGAGTGCACCATCATGCCTGG - Intronic
905887858 1:41501428-41501450 GTGGGTTGGAGCTTGATCCCTGG + Intergenic
906136821 1:43505867-43505889 TTGGGATGCAGCAACATGCCGGG - Intergenic
908295908 1:62712970-62712992 CTGGGTTGCAGAATCTTTCCAGG + Intergenic
911696188 1:100892884-100892906 CAGGGTTGCAGATAAATGCCAGG + Intronic
914797300 1:150931115-150931137 CTGGGGTGCACCACCATGCCTGG - Intronic
915370730 1:155347815-155347837 CTGGGCTGATGCCTCATGCCGGG + Exonic
916699363 1:167275165-167275187 CAGGCTTGCACCATCATGCCTGG + Intronic
921612484 1:217228825-217228847 CTGTGTTGCAGCTCCAGGCAGGG + Intergenic
922380993 1:225025610-225025632 CAGGCATGCAGCATCATGCCTGG - Intronic
1062922672 10:1291889-1291911 CTGGGCAGAGGCTTCATGCCTGG + Intronic
1066029925 10:31410323-31410345 ATGTGTTGCAGCTTCATCCCAGG + Intronic
1067176530 10:43953736-43953758 CAGGGTGGCAGCTCAATGCCAGG - Intergenic
1067552721 10:47246739-47246761 CTTGGTGACAGCTGCATGCCAGG + Intergenic
1070009319 10:72456820-72456842 CTGGGATGCACCACCATGCCGGG + Intronic
1070179969 10:74003860-74003882 CAGGGGTGCACCTCCATGCCTGG + Intronic
1070610494 10:77928883-77928905 CAGGCTTGCACCATCATGCCTGG - Intergenic
1070718404 10:78739353-78739375 CCTAGTTTCAGCTTCATGCCTGG - Intergenic
1072308700 10:94133431-94133453 CTGGTTGGCAGCTTCCTGCCAGG - Intronic
1072917207 10:99545410-99545432 CTGGTGTGCACCATCATGCCTGG - Intergenic
1075825196 10:125350357-125350379 CTAGTTTTCAGCTTCATGCCTGG - Intergenic
1077315376 11:1917330-1917352 CTTGGCTGCAGCTCCCTGCCTGG - Intergenic
1079755018 11:24247218-24247240 CTGGGTTGCATTTTCAGGGCTGG - Intergenic
1080660890 11:34295039-34295061 CAGGCTTGCACCTCCATGCCTGG - Intronic
1081618440 11:44604243-44604265 CTGGGTGCCCACTTCATGCCAGG - Intronic
1081763545 11:45593517-45593539 CTGGGCTGCAGATTCAAGACTGG + Intergenic
1085804948 11:79626948-79626970 CTGAGTTCCTGCTGCATGCCAGG - Intergenic
1090030361 11:123201035-123201057 GTGTGTACCAGCTTCATGCCTGG + Intergenic
1094527713 12:31243464-31243486 CTGGGATTAAGCTTCATACCTGG + Intergenic
1097743167 12:63269345-63269367 ATGGTTTCCAGCTTCATGCATGG + Intergenic
1099534029 12:83823810-83823832 CTGGCCTGCAGCTCCATGGCTGG + Intergenic
1100925986 12:99548864-99548886 CTGGGTTCCTGCTATATGCCAGG + Intronic
1101745669 12:107539570-107539592 CTGATTTGCTGCTTCATGCTGGG - Intronic
1102793977 12:115672720-115672742 CAGGGATGCAGCTCCGTGCCCGG - Intergenic
1104407407 12:128529641-128529663 CAGGGGTGCATCATCATGCCCGG - Intronic
1104885274 12:132103853-132103875 CTGGGTAGCAGTCTCGTGCCTGG + Intronic
1108669963 13:52675930-52675952 CTGGGTGGCAGAATCATCCCTGG + Intronic
1108729013 13:53213604-53213626 CTGGTTTTCAGCTTCATCTCTGG + Intergenic
1108971607 13:56382572-56382594 CAGGCTTGCACCATCATGCCTGG - Intergenic
1110315299 13:74099794-74099816 CTGTGTTGAAGCATCATGCTAGG - Intronic
1112785949 13:102952074-102952096 CGGTGTTGCAGCTGCCTGCCAGG - Intergenic
1113461013 13:110482132-110482154 CTGTGTCGCATCTCCATGCCAGG + Intronic
1117836397 14:59810928-59810950 CTGGGCTGCAGCTACAATCCAGG - Intronic
1117920425 14:60722311-60722333 CTGGGTTTGAGCTTTTTGCCTGG - Intronic
1118671035 14:68127438-68127460 CTGTGTTGCAGCATTATGCTAGG - Intronic
1119267172 14:73269818-73269840 CAGGGCTGCAGCGCCATGCCAGG + Intronic
1119736827 14:76987944-76987966 CTGTGTGACAGCTTCATCCCTGG + Intergenic
1121021146 14:90580873-90580895 CTGGCTCCCAGCTTCAGGCCTGG + Intronic
1121034120 14:90685082-90685104 CTGGGGTGCAGCTTCCTGGCAGG + Intronic
1121533325 14:94673678-94673700 GTGGGTGTCAGCCTCATGCCTGG + Intergenic
1121993399 14:98582926-98582948 CTGAGTTTCAGCCTCATTCCTGG - Intergenic
1122662499 14:103307008-103307030 CAGGGGTGCACCATCATGCCTGG + Intergenic
1122745748 14:103896367-103896389 CTGGGCTGCACCTTCAAGTCTGG - Intergenic
1123984803 15:25635864-25635886 CTGGGGTGCAGGTTTCTGCCAGG + Intergenic
1129749219 15:78048911-78048933 CTTGGATGCAGCTGCAAGCCTGG - Intronic
1130540001 15:84815736-84815758 CTGGGTTCCAGCTTTGTCCCTGG - Intergenic
1132539288 16:500907-500929 CTGGGTTGCAGCTTCATGCCTGG + Intronic
1133138499 16:3728634-3728656 CTGGGCTGCTGGTGCATGCCAGG + Exonic
1134647080 16:15877622-15877644 CTGGCATGCACCATCATGCCTGG - Intronic
1135539729 16:23320764-23320786 CTGGCCTTCAGCTTCAGGCCTGG + Intronic
1135750734 16:25056713-25056735 CTGGGATGGTGGTTCATGCCTGG - Intergenic
1138112595 16:54336837-54336859 CTGGGGAAAAGCTTCATGCCAGG - Intergenic
1138562577 16:57810694-57810716 CTGAGGGACAGCTTCATGCCAGG + Intronic
1138901546 16:61276382-61276404 CTGGTGTGCACCATCATGCCTGG + Intergenic
1139709108 16:68762395-68762417 CTGAGTGGCAACTACATGCCAGG - Intronic
1141399862 16:83738263-83738285 CTGGGTGTCTGTTTCATGCCAGG - Intronic
1141529015 16:84633257-84633279 CTGGCATGCACCATCATGCCTGG - Intergenic
1141640041 16:85335642-85335664 CAGGGTGGCAGTCTCATGCCCGG + Intergenic
1141764038 16:86046999-86047021 CTGAGTTGCACTTTCCTGCCTGG - Intergenic
1142329558 16:89442707-89442729 CTGGGTTCCAGCAACATTCCTGG - Intronic
1143509759 17:7388932-7388954 GTGGGTTGCAGCTGACTGCCAGG - Intronic
1146142100 17:30377328-30377350 CTGGATTGCAGCTTCCTTCCAGG + Intergenic
1146275862 17:31515206-31515228 CTGGGATGCAGCTTCAGGCTTGG + Intronic
1147434318 17:40398244-40398266 CTGGTATGCACCATCATGCCTGG + Intronic
1150622166 17:66815801-66815823 CAGGTTTGCATCATCATGCCCGG + Intergenic
1151523578 17:74648319-74648341 CTAGGTTTCAGCTTCAGGCGAGG - Intergenic
1152007429 17:77691393-77691415 CTGGGTTGCAGCTGAATCCCAGG + Intergenic
1152377484 17:79926282-79926304 CTGGGGTGCGGCTGCATTCCTGG - Intergenic
1152568562 17:81111290-81111312 CCGGGCTGCAGCTGCTTGCCGGG - Intronic
1152773411 17:82184975-82184997 CTGGGAAGCAGCTTTATCCCTGG + Intronic
1153529235 18:6027323-6027345 ATGGCTTCCAGCTTCATGCATGG + Intronic
1155144923 18:23075510-23075532 CTGGGCTGCAGCTCCAGGCTGGG + Intergenic
1155203530 18:23537660-23537682 CAGGGTGCCAGCGTCATGCCAGG - Intronic
1157295269 18:46437722-46437744 CTGGGTTGCGGCTTAAGGTCAGG - Intronic
1158485449 18:57862058-57862080 CTGGTGTGCACCATCATGCCTGG + Intergenic
1162066733 19:8130366-8130388 CAGGCATGCAGCTCCATGCCCGG - Intronic
1162453228 19:10767065-10767087 GTGGGGTGCAGCTTGATGGCAGG + Intronic
1162505203 19:11079634-11079656 CAGGCATGCAGCATCATGCCCGG - Intergenic
1162911534 19:13850475-13850497 CTGGGTTCGAGCCTCAGGCCGGG - Intergenic
1163039440 19:14591694-14591716 CAGGCTTGCACCATCATGCCTGG + Intronic
1163530034 19:17843512-17843534 CTGGGTTGCACTTTCATCCCAGG - Intronic
1165191044 19:34063689-34063711 CAGGGGTGCACCATCATGCCCGG - Intergenic
1165301721 19:34973997-34974019 CTGGGGTGCAGCCTGCTGCCCGG + Intergenic
926857614 2:17273800-17273822 CTGTGTTGCAGCCTTATGCTGGG + Intergenic
928328297 2:30337384-30337406 CTGAGCTGCAGCTGCTTGCCTGG + Intergenic
929581148 2:43082451-43082473 CGGGCTGGCAGCTTCAGGCCAGG + Intergenic
932183483 2:69670881-69670903 CTGGTGTGCACCATCATGCCTGG - Intronic
932382237 2:71295367-71295389 CTGGTGTGCACCATCATGCCTGG - Intronic
935118798 2:100161607-100161629 CTGGCATGCACCATCATGCCTGG - Intergenic
935384255 2:102484795-102484817 TTGGGTTCCAGCTTCAACCCTGG - Intronic
935667650 2:105526204-105526226 CTGGCTTGCAGCTTCTGGGCTGG - Intergenic
936817182 2:116473573-116473595 TTGGGTTGCTGTTTCAAGCCAGG + Intergenic
937435976 2:121881510-121881532 CTGGGGACCAGCTGCATGCCTGG + Intergenic
938766571 2:134463901-134463923 CTGGGTTGCTGCCTCCTGCCAGG - Intronic
940974124 2:159924481-159924503 CTGGGGAGTAGCTTCATGTCAGG + Intergenic
941065018 2:160892048-160892070 CTGTGATGCTGCTCCATGCCTGG + Intergenic
942275414 2:174318856-174318878 CAGGCTTGCACCATCATGCCCGG - Intergenic
944683479 2:202097549-202097571 CTGCGTTTCATCTTCCTGCCAGG - Exonic
946237238 2:218331608-218331630 CAGGCTTGCACCATCATGCCCGG + Intronic
947533056 2:230924869-230924891 CAGGGTTGCAGCATCATGTCGGG - Intronic
947707063 2:232284874-232284896 GTGGTGTGCAGCTCCATGCCAGG - Intronic
948274651 2:236699115-236699137 ATGGGTTCCAGCTACCTGCCTGG + Intergenic
948676982 2:239602555-239602577 GTGGTTTGCTGCTGCATGCCGGG - Intergenic
1169263102 20:4151880-4151902 CTGGGCATCAGCTACATGCCAGG - Intronic
1170203046 20:13765613-13765635 CTGGGTGGCTGCTTAATGTCAGG - Intronic
1170842269 20:19933594-19933616 ATGGGCTCCCGCTTCATGCCAGG - Intronic
1171436896 20:25131015-25131037 TTGGGTTGCAGCTCCCTTCCCGG + Intergenic
1171960276 20:31488503-31488525 CTGAGCAGAAGCTTCATGCCTGG - Intergenic
1172497140 20:35395624-35395646 CTGGGTTGCAGCCACAGGCCAGG + Intronic
1172914055 20:38430732-38430754 CTGCGTTTCAGATTCAAGCCTGG - Intergenic
1173236440 20:41250074-41250096 CTGGGATGCAGCTTGCTTCCTGG - Intronic
1174011862 20:47456142-47456164 CAGGCATGCAGCATCATGCCTGG + Intergenic
1174478608 20:50815146-50815168 TTGGGTTCCAGCTGCATGGCTGG + Intronic
1175829489 20:61954344-61954366 CTGGGCTCCAGCTCCAGGCCTGG - Intronic
1179169760 21:38963709-38963731 CTGTGTTGCTGCTTCTTGGCTGG + Intergenic
1179296713 21:40069382-40069404 CTGATGTGCACCTTCATGCCAGG - Intronic
1180963867 22:19775763-19775785 CTGGGGCACCGCTTCATGCCAGG - Intronic
1180979138 22:19870528-19870550 CAGGGCTGCAGCTTCAGACCTGG - Intergenic
1181321476 22:22010194-22010216 CTGGGATGCAGTTTAAGGCCTGG + Intergenic
1181761618 22:25062647-25062669 CTGGGCTGCTGCTTCTTGCTGGG + Intronic
1181819776 22:25466725-25466747 CTGGTTTTCAGCTTCGTGCTGGG - Intergenic
1181926056 22:26359660-26359682 CTGGCGTGCACCATCATGCCTGG - Intronic
1183063194 22:35347745-35347767 CAGAGTTGCAGCTTCGTACCTGG - Exonic
1184988296 22:48150763-48150785 CAGGGGTGCAGCACCATGCCCGG + Intergenic
949179840 3:1115607-1115629 CAGGCATGCACCTTCATGCCCGG - Intronic
949710356 3:6863614-6863636 CTGGGTTTCAGCTACAAGCCAGG - Intronic
952025416 3:29074884-29074906 CAGGCATGCAGCATCATGCCCGG - Intergenic
952366206 3:32677179-32677201 CAGGCATGCAGCATCATGCCTGG - Intergenic
952750340 3:36820037-36820059 TTGGGTTGCAGCTTTCTGCAGGG + Intergenic
952945303 3:38474980-38475002 CTGCAGTGCAGCTTCATGGCTGG + Intronic
953200535 3:40774488-40774510 CTGGTCTGCAGCTACATACCTGG - Intergenic
953879616 3:46684863-46684885 CTGGGCAGCAGCTTCCTGCCAGG + Intronic
954799242 3:53177670-53177692 CTGGGTACCTGCTCCATGCCAGG - Intronic
955082706 3:55672806-55672828 CTGGGTTGCATTTCCATGGCAGG - Intronic
956666365 3:71645676-71645698 CAGGCTTGCACCATCATGCCTGG + Intergenic
963030596 3:140970972-140970994 CTCGGTTACAGCTTGATGCAAGG + Exonic
963681840 3:148388146-148388168 CTCTGTTGCAGTTTCCTGCCTGG + Intergenic
963972252 3:151443103-151443125 CTGGGATGCAGCTTCTATCCTGG + Exonic
968234099 3:197021597-197021619 CTGGGTTCCAGCTCCCTGGCTGG + Intronic
968909804 4:3471958-3471980 CTTGGGCGCAGCTGCATGCCAGG - Intronic
969655494 4:8495358-8495380 CTGGGCTGCAGCCTCCTGGCAGG + Intergenic
971371061 4:26019317-26019339 CTGGGTGTCTGCTACATGCCAGG + Intergenic
971934017 4:33123670-33123692 CTGGGTTGCTTCTTCATGATAGG - Intergenic
972762588 4:42121702-42121724 CCCGGTTGCAGTTTCATGGCAGG + Intronic
973318508 4:48785996-48786018 CAGGGTTGCACCACCATGCCCGG + Intergenic
974691763 4:65305817-65305839 CTGGCTGGCAGCATCATGACAGG - Intergenic
976020882 4:80623931-80623953 CTGGGTTGCTGCCTGAAGCCTGG - Intronic
977569109 4:98611705-98611727 CTGGGTCGCACATTCTTGCCTGG - Intronic
980838215 4:138224117-138224139 CTGGTATCCAGCTCCATGCCTGG + Intronic
985096741 4:186420328-186420350 ACTGTTTGCAGCTTCATGCCGGG + Intergenic
985558912 5:571791-571813 GTGGGTTCCAGCTTTATTCCAGG - Intergenic
985590308 5:761190-761212 CTGTATTGCACCTTCATGGCAGG - Intronic
987242666 5:16016683-16016705 CTGCATTGCAGCATCAAGCCTGG - Intergenic
989225450 5:39022548-39022570 CTGTGTTGCAGCTAAAGGCCTGG + Intronic
989242225 5:39214783-39214805 CAGGCTTGCACCATCATGCCTGG - Intronic
992165325 5:74044575-74044597 CAGGCTTGCACCATCATGCCCGG + Intergenic
992744207 5:79803403-79803425 GTGTGTTGCAGCTTGATGCCAGG + Intergenic
993267537 5:85744958-85744980 CTGGGATACAGCTTCGTGCTTGG - Intergenic
994832404 5:104802076-104802098 CTGGGTAGCAGCATTATGACAGG + Intergenic
995688843 5:114800771-114800793 CAGAGTTGGAACTTCATGCCTGG + Intergenic
996374434 5:122789566-122789588 CTGTAGTGCAGCTCCATGCCTGG + Intronic
997349949 5:133223542-133223564 GTGGGGTGCAGGTGCATGCCCGG - Intronic
999996488 5:157097395-157097417 CAGGTTTGCAGCACCATGCCTGG + Intronic
1000480199 5:161763838-161763860 CTGGGTTGAAGCTTCAGACAGGG - Intergenic
1001527593 5:172439877-172439899 CTGGGCTGGAGCTGCACGCCTGG - Intronic
1001593662 5:172883838-172883860 CAGGGATGCACCATCATGCCTGG - Intronic
1004869987 6:19894908-19894930 CTGGGCTGCAGCTTCAGGATGGG - Intergenic
1006814532 6:36840870-36840892 CTGCGCTGCAACCTCATGCCCGG - Intergenic
1006977933 6:38121231-38121253 CAGGGTTGCACCATCTTGCCTGG - Intronic
1008824526 6:55677245-55677267 CAGGTGTGCAGCGTCATGCCTGG - Intergenic
1018198475 6:161375216-161375238 CTGGGGTGCAGCTTCCGGCCAGG - Intronic
1019436797 7:1026397-1026419 CTGTGCTGCAGCTCCCTGCCAGG + Intronic
1019702140 7:2479140-2479162 CTGAGTTCCAGCTCCATGCTGGG - Intergenic
1020082763 7:5295647-5295669 CTGGGCTTCCGCTTCCTGCCTGG - Intronic
1024082640 7:45867728-45867750 CTGGCTTGCAGCTTCTTCCCAGG + Intergenic
1025211505 7:57021530-57021552 CTGGGCTTCCGCTTCCTGCCTGG + Intergenic
1025660450 7:63555317-63555339 CTGGGCTTCCGCTTCCTGCCTGG - Intergenic
1025833752 7:65076950-65076972 CTGGTGTGCACCATCATGCCTGG + Intergenic
1025903522 7:65766462-65766484 CTGGTGTGCACCATCATGCCTGG + Intergenic
1025955765 7:66181774-66181796 CTGGCATGCACCATCATGCCTGG + Intergenic
1027206437 7:76103628-76103650 CAGGTTTGCACCATCATGCCTGG - Intergenic
1028439931 7:90848242-90848264 CAGGCTTGCATCATCATGCCTGG + Intronic
1029401837 7:100351919-100351941 CTGGGTTGCAGGTTTAAGCGTGG + Intronic
1030043315 7:105471767-105471789 CAGGCTTGCAGCACCATGCCTGG - Intronic
1030159448 7:106492507-106492529 CTGGGATGCTACTTCATGCGTGG - Intergenic
1030207869 7:106968134-106968156 CTGGGAGGTAGCTTCATTCCTGG - Intergenic
1032317734 7:130855575-130855597 CTTGCTTCCAGGTTCATGCCTGG + Intergenic
1034956852 7:155340188-155340210 CTGGGCTGCAGCCACAGGCCAGG - Intergenic
1035556331 8:569789-569811 CTGGGTTGCAGACTCAAGCGTGG + Intergenic
1035723285 8:1809061-1809083 CAGGTGTGCACCTTCATGCCCGG + Intergenic
1037620808 8:20561931-20561953 CTGGGCTAAAGCTTCTTGCCTGG + Intergenic
1038223346 8:25631601-25631623 CAGGGCTGCAGCTTCCTGCACGG - Intergenic
1038663895 8:29520803-29520825 CTGGCTGGCACCTTCCTGCCAGG + Intergenic
1039742120 8:40392483-40392505 TTGGGGTGGAGCTGCATGCCTGG + Intergenic
1040533842 8:48288875-48288897 CTGAGTTGCAGCCTCAGTCCTGG + Intergenic
1048930391 8:139310578-139310600 CTGGAATGCAGCTTTTTGCCTGG + Intergenic
1053273881 9:36768932-36768954 CTGGGTGGCATCTGCATTCCAGG + Intergenic
1053490810 9:38500320-38500342 CTGTGCTGCTGCTTCATGCCTGG - Intergenic
1053545907 9:39022742-39022764 CAGGTGTGCACCTTCATGCCAGG + Intergenic
1054913667 9:70476830-70476852 TTGGGTTGTCCCTTCATGCCTGG + Intergenic
1054925511 9:70584910-70584932 CTGGGGTGCAGAGTCATGACTGG + Intronic
1057671126 9:97089537-97089559 CTGTGCTGCTGCTTCATGCCTGG - Intergenic
1057894692 9:98899607-98899629 GTGGGTTGTGGCTCCATGCCAGG - Intergenic
1058674826 9:107391293-107391315 CAGGGATGCACCATCATGCCCGG + Intergenic
1059177118 9:112177190-112177212 CAGGGGCGCAGCATCATGCCTGG + Intergenic
1060489307 9:124070651-124070673 CAGGTGTGCACCTTCATGCCTGG + Intergenic
1061713256 9:132502130-132502152 CTGCGTGGCAGCATCCTGCCCGG + Intronic
1061741402 9:132708859-132708881 CTTGCTTGCAGCTTCATCCTTGG + Intergenic
1061759939 9:132843612-132843634 CTGCGGTTCAGCTTCATCCCTGG - Intronic
1062682958 9:137792991-137793013 CTGGGTTGGGGTTTCATGCGCGG + Intronic
1185488105 X:498441-498463 CTCGGATGCAGCTACATCCCAGG - Intergenic
1185595961 X:1307161-1307183 CTGGGATGCAGCATCAGCCCTGG - Intronic
1186000296 X:5001963-5001985 CTGGTGTGCACCATCATGCCTGG - Intergenic
1186030752 X:5366539-5366561 CAGGTGTGCAGCATCATGCCCGG - Intergenic
1187075470 X:15930091-15930113 CTGGGTGAAAGCTGCATGCCAGG + Intergenic
1192756353 X:74050016-74050038 CTGTGTTGCAGGTCCAAGCCAGG - Intergenic
1192757242 X:74059057-74059079 CTGGTATGCAGCACCATGCCTGG - Intergenic
1196333256 X:114497474-114497496 CAGGTGTGCACCTTCATGCCTGG + Intergenic
1196342948 X:114617295-114617317 CAGGTTTGCACCATCATGCCTGG - Intronic
1201910794 Y:19131868-19131890 CTGGGTTGCAGCTGCTGGCTGGG - Intergenic
1202165626 Y:21984494-21984516 ATGGTTTCCAGCTTCATGCATGG + Intergenic
1202225732 Y:22601878-22601900 ATGGTTTCCAGCTTCATGCATGG - Intergenic
1202317381 Y:23593783-23593805 ATGGTTTCCAGCTTCATGCATGG + Intergenic
1202553384 Y:26076275-26076297 ATGGTTTCCAGCTTCATGCATGG - Intergenic