ID: 1132541821

View in Genome Browser
Species Human (GRCh38)
Location 16:513686-513708
Sequence TCTTAGCTTTAAGAGCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 184}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132541821_1132541824 7 Left 1132541821 16:513686-513708 CCTTCCAGCTCTTAAAGCTAAGA 0: 1
1: 0
2: 0
3: 12
4: 184
Right 1132541824 16:513716-513738 CTTATCTAAGAAGAGCTCCTAGG 0: 1
1: 0
2: 0
3: 12
4: 136
1132541821_1132541825 22 Left 1132541821 16:513686-513708 CCTTCCAGCTCTTAAAGCTAAGA 0: 1
1: 0
2: 0
3: 12
4: 184
Right 1132541825 16:513731-513753 CTCCTAGGCATTTTCAAAACTGG 0: 1
1: 0
2: 1
3: 7
4: 186
1132541821_1132541827 25 Left 1132541821 16:513686-513708 CCTTCCAGCTCTTAAAGCTAAGA 0: 1
1: 0
2: 0
3: 12
4: 184
Right 1132541827 16:513734-513756 CTAGGCATTTTCAAAACTGGTGG 0: 1
1: 0
2: 1
3: 11
4: 317
1132541821_1132541828 29 Left 1132541821 16:513686-513708 CCTTCCAGCTCTTAAAGCTAAGA 0: 1
1: 0
2: 0
3: 12
4: 184
Right 1132541828 16:513738-513760 GCATTTTCAAAACTGGTGGCAGG 0: 1
1: 0
2: 1
3: 14
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132541821 Original CRISPR TCTTAGCTTTAAGAGCTGGA AGG (reversed) Intronic
900766170 1:4507203-4507225 TCTTAGCTTACAGAGAAGGAAGG + Intergenic
901119230 1:6876933-6876955 GCATAGTTTTTAGAGCTGGAAGG + Intronic
901223038 1:7594768-7594790 TCAGAGCTTGAAGAGCTGCATGG + Intronic
901656514 1:10772803-10772825 TCTGAGCATGAAGAGCTGTATGG + Intronic
902613870 1:17613113-17613135 TCTTGGCTTTGAGAGTTGGGGGG + Exonic
903874749 1:26465992-26466014 TTTTAGATTTAAGTACTGGAGGG + Intronic
906976959 1:50586115-50586137 TCATAGATTTTAAAGCTGGAAGG + Intronic
907202474 1:52739386-52739408 CCTTTTCTTTAAGAGATGGAAGG - Intronic
911809239 1:102252976-102252998 TCTTTGCTTTAAAAGCTCCAAGG + Intergenic
915623944 1:157103190-157103212 TCTTTTATTTAAGAGCTGTATGG - Intergenic
916525913 1:165609303-165609325 TTTCAGCTTTATGAACTGGAAGG - Intergenic
917354646 1:174113832-174113854 TTTTAGCATTAAATGCTGGAAGG + Intergenic
920194712 1:204219285-204219307 TCTTAGTTTTAAGAGCTGCCAGG + Exonic
920698477 1:208199913-208199935 TCATAGATTTAGTAGCTGGAGGG - Intronic
922849912 1:228723617-228723639 TCTTAGCTCTTAGAGCCTGACGG - Intergenic
1065643056 10:27804820-27804842 TCTTGGCTTAAAGAGAGGGAAGG - Intergenic
1066248700 10:33611933-33611955 TCCTAGATTTCAGAGCTGGTGGG - Intergenic
1068388612 10:56362489-56362511 TCTTACTTTTAAGAGTTAGATGG - Intergenic
1069166206 10:65163647-65163669 TGTTAGCTTTAGAATCTGGAGGG - Intergenic
1070103259 10:73408557-73408579 TCTTACCTTTAAGAGCCTGGAGG + Intronic
1076021819 10:127080062-127080084 TCCTAGCTGTAAGAGGTGAATGG - Intronic
1077930580 11:6727924-6727946 TCTTATATTTAAGAATTGGAAGG + Intergenic
1078447379 11:11414522-11414544 TCTGAGCTTTAAAGGATGGAAGG - Intronic
1080683606 11:34497547-34497569 CTTTAGCTTTCAGAGCTGGGTGG + Intronic
1080863170 11:36168220-36168242 TCTTAGCTTTATGATCTTGTTGG - Intronic
1082803721 11:57433033-57433055 TGTTTGCTTTAAGACCTGGAGGG - Intergenic
1084214671 11:67640877-67640899 TCTCAGCCTGCAGAGCTGGATGG + Intergenic
1084629883 11:70341108-70341130 TCGTCCCTTTAAGAGGTGGAGGG - Intronic
1084630487 11:70345205-70345227 TCGTCCCTTTAAGAGGTGGAGGG - Intronic
1086428641 11:86713736-86713758 TCTTTGCCTTGAGAGCTGGTTGG - Intergenic
1088908691 11:114174051-114174073 TAATAGCTTTAAGTGCTGGGAGG + Intronic
1089298811 11:117485527-117485549 AGTTAGCTTTAAGGGGTGGAAGG - Intronic
1089331254 11:117690514-117690536 TCTGAGATTTCCGAGCTGGAAGG + Intronic
1090910818 11:131117848-131117870 TCTTTACTCTTAGAGCTGGAAGG - Intergenic
1091701581 12:2666907-2666929 TCTGAGAATTTAGAGCTGGAAGG - Intronic
1092805397 12:12217588-12217610 TCTTAGCTTTAAAAGCTATAGGG + Intronic
1093764672 12:22949594-22949616 TCTTATATTTAAGAAATGGAAGG - Intergenic
1097928377 12:65156849-65156871 TTTTAACTTTAATAGCTGTATGG + Intergenic
1101253543 12:102956877-102956899 TCCTAGTTTTTAGAGCTGAATGG + Intronic
1101621342 12:106391608-106391630 TCATAGCATTTTGAGCTGGAAGG + Intronic
1102631311 12:114283067-114283089 TCTTAGGTTGAAGAGATGGCAGG - Intergenic
1107746355 13:43514499-43514521 TATTATCTTAAACAGCTGGAAGG + Intronic
1108165966 13:47693399-47693421 ACTGAGCTTTGAGAGCAGGAGGG - Intergenic
1108594727 13:51939659-51939681 TCTTAGCTATAGAAGCAGGAGGG + Intronic
1108615777 13:52130430-52130452 TCATCTCTTTAAGACCTGGATGG + Intergenic
1118047856 14:61991825-61991847 TCTTGGATTTAAGAGCAGAAAGG + Intergenic
1121136557 14:91504149-91504171 TCTTTTTTTTAAGAGATGGAAGG - Intronic
1126415231 15:48411244-48411266 TCAGAGTTGTAAGAGCTGGAAGG + Exonic
1126607212 15:50490367-50490389 GCTTGGCTTTATGAGTTGGAGGG - Exonic
1127692495 15:61411782-61411804 GCTTAGCCTCAAGAGCTGCAAGG - Intergenic
1128561758 15:68673220-68673242 TCTCATCTTTAAGAGATTGATGG - Intronic
1129073165 15:72968855-72968877 TCTAAGATTTAAGACCTGGTTGG + Intergenic
1129898759 15:79129516-79129538 CCTTATCTTGAAAAGCTGGAGGG - Intergenic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1132541821 16:513686-513708 TCTTAGCTTTAAGAGCTGGAAGG - Intronic
1135182983 16:20291514-20291536 TCATTGCTTTCAGAGCTGGAAGG + Intergenic
1135331078 16:21560259-21560281 AATTAGTTTTAAGAGCTGGGTGG - Intergenic
1135927007 16:26704031-26704053 TCTTACCTTAAGAAGCTGGAAGG + Intergenic
1143477949 17:7213701-7213723 ACTGGGTTTTAAGAGCTGGAAGG - Intronic
1143757991 17:9080381-9080403 TGTTAGAGTTAAGAGGTGGATGG + Intronic
1144557364 17:16294143-16294165 TCCTAGACTTAAGAGTTGGAAGG + Intronic
1144793926 17:17878335-17878357 TCTCAGCTTCAAGAGCAGGCTGG + Intronic
1145771379 17:27495584-27495606 TCACAGATTTCAGAGCTGGAAGG - Intronic
1148871431 17:50660793-50660815 TCTTGGCTCTCAGAGCTGGGAGG - Intronic
1156749810 18:40438239-40438261 CATTAGCTTTGAAAGCTGGAAGG + Intergenic
1156934862 18:42691182-42691204 TCTTAGTGGTAAGATCTGGAAGG + Intergenic
1157649423 18:49312825-49312847 TCTTGGCTTTGAGAGCTAAATGG + Intronic
1158081160 18:53592378-53592400 TTTTAGCTTTAAGAGATGCCAGG - Intergenic
1158756442 18:60331648-60331670 TCTTTTCTCTCAGAGCTGGAAGG + Intergenic
1164300826 19:23961663-23961685 TCTTAGATTTTATAGCTGGGTGG - Intergenic
1167533556 19:50034132-50034154 TTTTAGCCTGAACAGCTGGAAGG - Intronic
1168638469 19:58014364-58014386 TCTTAGCTGAGAAAGCTGGATGG - Intergenic
930887818 2:56348273-56348295 TGTTGGCTTCAAGAGGTGGATGG - Intronic
930951319 2:57146780-57146802 TCTTAGCTTTCAGGGCTCCATGG - Intergenic
932545717 2:72707031-72707053 GCTTAGGCTTGAGAGCTGGAAGG - Intronic
933692364 2:85189437-85189459 CCTTTTCTTTAAGAGCAGGATGG - Intronic
934603063 2:95672966-95672988 TCTTTGCTTTAGGATCTAGATGG - Intergenic
935400565 2:102656003-102656025 TGATAGCTGTAAGAGGTGGATGG - Intronic
936224679 2:110637347-110637369 TGTTGACTTTCAGAGCTGGAAGG - Intergenic
936536447 2:113315163-113315185 TCTTTGCTTTAGGATCTAGATGG - Intergenic
937285274 2:120746703-120746725 TCTTAGTTTTAAGATCTTGGGGG - Intronic
939933442 2:148259305-148259327 TCTTTGCTTGCAGAGTTGGATGG - Intronic
940971542 2:159901984-159902006 TAGTAGGTTGAAGAGCTGGAAGG + Intronic
941645465 2:168035712-168035734 TCATGGCATTCAGAGCTGGAAGG + Intronic
941737578 2:168996172-168996194 TTTTAGATTTAAGTGTTGGAAGG - Intronic
943651339 2:190460940-190460962 TGTTTGCTTCAAGAGCTGCATGG - Intronic
944298803 2:198098780-198098802 TCTTACTGGTAAGAGCTGGAAGG + Intronic
945622704 2:212161092-212161114 TTTTAGCATTAAAAGATGGAAGG + Intronic
947650672 2:231783990-231784012 TCTTTGCTTTTAGAGTTGGCAGG + Intronic
948400698 2:237682882-237682904 TCTCAGCTTATACAGCTGGATGG - Intronic
1169932429 20:10848944-10848966 TCTTTGCTGTAAAAGCTGGAAGG - Intergenic
1170144580 20:13158946-13158968 TCTTAGCATTAAGAGATTGCTGG - Intronic
1170850819 20:20003066-20003088 TCTTAGTTTGAAGAGTTGGGAGG - Intergenic
1170945484 20:20887674-20887696 GCTTAGCTTTCAGTGCTGGAAGG + Intergenic
1171294853 20:24008532-24008554 TCTTAGCCTGAACAACTGGAAGG - Intergenic
1171393080 20:24814017-24814039 GCTCAGCTTTAAGAGCTGTTTGG + Intergenic
1172723076 20:37014006-37014028 CCATAGCTCTAAGAACTGGAAGG + Intronic
1173591998 20:44231945-44231967 TCGCAGCTTCAAGAGCTGGGTGG + Intergenic
1173971222 20:47153844-47153866 TCTGAGCTCTAAGACCTTGAAGG + Intronic
1176876988 21:14140319-14140341 TCTTGGCTTAAACAACTGGAAGG + Intronic
1178763234 21:35424048-35424070 TCTTCACTATAAGAGTTGGATGG + Intronic
1179073961 21:38100539-38100561 TCTTAGCTGTCAGAGAAGGAAGG + Intronic
1180109063 21:45639420-45639442 TCTTAGCGTGAAGAGCTGAGAGG + Intergenic
1180701412 22:17783346-17783368 CCTTGGCTTTGAGAGCTGGACGG - Intergenic
1182314098 22:29432106-29432128 TCTTAGCTAAGAAAGCTGGATGG + Intergenic
1183344019 22:37296916-37296938 TCCTAGTTTTAGGAGTTGGAGGG - Intronic
949876658 3:8630469-8630491 TTTTAGCTTAAACAGCTGAAGGG - Intronic
950944146 3:16927536-16927558 TCAGAAGTTTAAGAGCTGGAAGG + Intronic
951034994 3:17923053-17923075 TCTTAGGTCTCAGAGCTAGAAGG - Intronic
951059547 3:18189096-18189118 TCTAAGCTTTAAAAGGTGGGAGG - Intronic
951940259 3:28069835-28069857 ATTTAGCATTAACAGCTGGAAGG - Intergenic
952270386 3:31825147-31825169 TGTTTGCTTTAAGAGCAGAAAGG + Intronic
954174608 3:48834140-48834162 TCTGAGCTTTTACTGCTGGACGG - Intronic
955467009 3:59247804-59247826 TCATACCTTTAGGAGCTGGCTGG + Intergenic
960967526 3:123115501-123115523 CCTTTGCTGTCAGAGCTGGAAGG + Intronic
963335283 3:143968302-143968324 TCTTCGCTTTTAGAGATGTAAGG - Intergenic
966638450 3:182161595-182161617 TCTTGGATTTAAAAGCTGGTTGG - Intergenic
968179272 3:196579332-196579354 TCTGAGGTATAAAAGCTGGAAGG + Intronic
968524225 4:1047818-1047840 TCTTAGCTTTAAAATCTCCATGG - Intergenic
969371610 4:6734846-6734868 TCAAATCTTTCAGAGCTGGAAGG + Intergenic
970230507 4:13905753-13905775 TCATGACTTTCAGAGCTGGAAGG + Intergenic
971042870 4:22774562-22774584 TATAGGCTTTTAGAGCTGGAAGG + Intergenic
975598302 4:76071775-76071797 TTTTAGCTTGAATAGCTGGAAGG - Intronic
977201712 4:94123995-94124017 TCTTAGGTTTAAGATTTGGCCGG - Intergenic
978202850 4:106043281-106043303 TATCAGATTTTAGAGCTGGATGG + Exonic
978266425 4:106831693-106831715 TTTGAGCTTTAAGACCAGGAGGG + Intergenic
981443467 4:144809100-144809122 TCTTAGCTTTCTGAGCTCCATGG - Intergenic
985044068 4:185922438-185922460 TGTGAGTTATAAGAGCTGGAAGG - Intronic
986010428 5:3709730-3709752 GCTTTGCTTTCAGAGCTGGTGGG + Intergenic
989102503 5:37835548-37835570 TCATAACTTTAAGAGGTGGGAGG - Intronic
989610116 5:43282693-43282715 TCTTAGTGTTAAGAGGTGGGAGG + Intergenic
990702584 5:58490196-58490218 ACTTGGCTTTAAGTGCTGCAGGG + Intergenic
990770613 5:59240091-59240113 TGTTAGTTTTAATAACTGGAAGG - Intronic
991314390 5:65283808-65283830 TCTTAATTTTTACAGCTGGAAGG - Intronic
991499521 5:67263295-67263317 TCTTAGCTTAAAGGACTAGAGGG - Intergenic
992269100 5:75047769-75047791 TCTTAGGTTTTAGAGCTTGGGGG + Intergenic
993289833 5:86052906-86052928 ACTAAGCTTTAAAAGCTGGTGGG + Intergenic
993478244 5:88390986-88391008 ACTTTGCTTTAAGAGCTGCAGGG - Intergenic
994086806 5:95767874-95767896 ACTTACCTTTAAGAACTGTATGG - Intronic
995374201 5:111455514-111455536 GGATAGTTTTAAGAGCTGGAAGG - Intronic
995474565 5:112534650-112534672 TCTTTGCTTTCAGATCTGGAAGG + Intergenic
996631070 5:125633157-125633179 TCTTAGATTTATGAGGTGGTTGG + Intergenic
996910893 5:128655893-128655915 TCTTAGCTTGAAGGGCTCCATGG + Intronic
997053885 5:130416929-130416951 TCATAGCTATAAGAGTTGCAAGG + Intergenic
999280759 5:150364009-150364031 CATTGCCTTTAAGAGCTGGAAGG + Intronic
1000750461 5:165089295-165089317 TGTTGGCTTTCACAGCTGGAGGG - Intergenic
1003605217 6:7553761-7553783 TCTTGGTTTCGAGAGCTGGATGG + Intronic
1004476564 6:15979002-15979024 ACTCAGTTTTAAGAGCTGGCAGG + Intergenic
1006757407 6:36428482-36428504 TCTTACCTGAAAGAGCTGGCCGG + Intronic
1006980697 6:38145573-38145595 TGTTAGCTTTAAAAGCTATAGGG + Intronic
1008673084 6:53793764-53793786 TTTTAGCTATAGCAGCTGGAGGG + Intergenic
1008721877 6:54364022-54364044 TTTTATCTTTAGGAGCTAGAAGG + Intronic
1009666220 6:66684501-66684523 TCTTAGATTTCAGAGCTCCATGG + Intergenic
1010798459 6:80145912-80145934 TATTAGCTCTAAGAGCTTGTTGG + Intronic
1010958638 6:82120113-82120135 TGTTAGCTTGCAGAGCTGGGAGG - Intergenic
1011399393 6:86943454-86943476 TCTTGGCTGTATGAGCTGCATGG + Intronic
1014188204 6:118459670-118459692 TCTTAGAAATAAGAGCAGGAAGG - Intergenic
1014727653 6:124991709-124991731 TGTAAGATTTTAGAGCTGGAAGG + Intronic
1015617550 6:135093291-135093313 TCCTATCTTAAAGAGCTTGAAGG - Intronic
1016104365 6:140143926-140143948 TCATAGCTCAAAGAGCTGCAAGG - Intergenic
1016487708 6:144561048-144561070 AATTAGCATTAAGAGATGGAAGG - Intronic
1017255591 6:152329761-152329783 GCTGAGCTCTCAGAGCTGGATGG - Exonic
1018189859 6:161301196-161301218 TCTTAGCTTCCTGGGCTGGAGGG + Intergenic
1021762849 7:23918165-23918187 TTTTAGCTTGAATAACTGGATGG - Intergenic
1025155431 7:56601900-56601922 TCTTGGCTTTTATAGCTGGGTGG - Intergenic
1025218280 7:57079172-57079194 TCTGATCTTTAAGAGCAGTAAGG + Intergenic
1025653065 7:63491289-63491311 TCTGATCTTTAAGAGCAGTAAGG - Intergenic
1025762851 7:64410647-64410669 TCTTGGCTTTTATAGCTGGGTGG + Intergenic
1028385160 7:90245558-90245580 TCTGTGCTTTCAGAGGTGGAGGG + Intronic
1030085904 7:105815506-105815528 TGTTAGCTTCAAAAGTTGGAGGG + Intronic
1030415134 7:109233876-109233898 TTATAGCTGAAAGAGCTGGAAGG + Intergenic
1031488465 7:122358733-122358755 TATTAACTTTAAAAGCTGTAAGG - Intronic
1032247643 7:130226476-130226498 TTCTAGCTTTATGAGCTGGCTGG - Intergenic
1033566985 7:142588263-142588285 TCTTAGCTGAAAGGACTGGAGGG + Intergenic
1034470721 7:151253080-151253102 TCTTGGATTTCAGAGCTGGAAGG - Intronic
1038484554 8:27924528-27924550 TCTTAGATTAAAGTGCTGGGTGG - Intronic
1043743057 8:83838465-83838487 TCTTAGCATTAACAGCTTCAGGG - Intergenic
1044759696 8:95505148-95505170 TATGAGATTTTAGAGCTGGAAGG + Intergenic
1045595956 8:103656916-103656938 TCTTCACTTTCAGAGCTTGATGG - Intronic
1045836769 8:106531511-106531533 TCTTAGTTTTCTGAGCTAGAGGG + Intronic
1047729329 8:127713735-127713757 TCTACACTTTCAGAGCTGGAAGG + Intergenic
1048512160 8:135072599-135072621 TTCAAGCTTTAAGAGCAGGAGGG + Intergenic
1049416494 8:142497848-142497870 TGGCAGCTTTCAGAGCTGGAGGG + Intronic
1050234400 9:3562811-3562833 TCTTACCTTGAAGAGCTCCATGG + Intergenic
1052754023 9:32522885-32522907 TTTCAGCTTTAAGATCAGGAGGG - Intronic
1058004390 9:99900368-99900390 TGTTAGCATTCAGATCTGGAGGG + Intergenic
1058472624 9:105296881-105296903 TCATAGATTTTAGAGTTGGAAGG + Intronic
1188580094 X:31701325-31701347 TCTTAACTTGAATAGTTGGATGG - Intronic
1188581102 X:31715246-31715268 TCTTAAGATTAAGAGCTGGCCGG + Intronic
1190335475 X:49259186-49259208 TTTTAGCTTGAGCAGCTGGAAGG + Intronic
1190981859 X:55463450-55463472 TCTTATTTTCCAGAGCTGGAAGG - Intergenic
1190986839 X:55509730-55509752 TCTTATTTTCCAGAGCTGGAAGG + Intergenic
1192094967 X:68201074-68201096 CCTTAGCTGTAAGATCTGAAAGG + Intronic
1193010629 X:76671253-76671275 TCTTAGCTTGAAGGGCTCCATGG - Intergenic
1200984176 Y:9288680-9288702 TGTAAGCTTTAAAAGCTGCAGGG - Intergenic
1201283739 Y:12361936-12361958 TCTTAGCTGAAAAAGCTGGATGG - Intergenic
1201297708 Y:12478524-12478546 TCTTAGCTGAAAAAGCCGGACGG - Intergenic