ID: 1132542617

View in Genome Browser
Species Human (GRCh38)
Location 16:518119-518141
Sequence ACTAGGCTGGAGCGCAGTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 11129
Summary {0: 1, 1: 5, 2: 325, 3: 6787, 4: 4011}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132542617 Original CRISPR ACTAGGCTGGAGCGCAGTGG CGG Intronic
Too many off-targets to display for this crispr