ID: 1132543134

View in Genome Browser
Species Human (GRCh38)
Location 16:520767-520789
Sequence TCCTGTCGATGTAGTCCTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 30}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132543134_1132543138 16 Left 1132543134 16:520767-520789 CCTGCAGGACTACATCGACAGGA 0: 1
1: 0
2: 0
3: 3
4: 30
Right 1132543138 16:520806-520828 GGAGACCAACCCGTCCATCCTGG 0: 1
1: 0
2: 1
3: 17
4: 872
1132543134_1132543144 30 Left 1132543134 16:520767-520789 CCTGCAGGACTACATCGACAGGA 0: 1
1: 0
2: 0
3: 3
4: 30
Right 1132543144 16:520820-520842 CCATCCTGGAGGTCAAGTAGAGG 0: 1
1: 0
2: 1
3: 10
4: 176
1132543134_1132543136 -5 Left 1132543134 16:520767-520789 CCTGCAGGACTACATCGACAGGA 0: 1
1: 0
2: 0
3: 3
4: 30
Right 1132543136 16:520785-520807 CAGGATCATCGTGGCCATCATGG 0: 1
1: 0
2: 7
3: 411
4: 9908
1132543134_1132543139 19 Left 1132543134 16:520767-520789 CCTGCAGGACTACATCGACAGGA 0: 1
1: 0
2: 0
3: 3
4: 30
Right 1132543139 16:520809-520831 GACCAACCCGTCCATCCTGGAGG 0: 1
1: 0
2: 1
3: 7
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132543134 Original CRISPR TCCTGTCGATGTAGTCCTGC AGG (reversed) Exonic
900098108 1:948576-948598 TCCTGTTGAAGTCGACCTGCTGG + Exonic
908609554 1:65842026-65842048 TCCCTTCGATGTAGTCATGGAGG + Intronic
918375003 1:183900218-183900240 TCACCTCGATGTAGTCCTGAAGG - Exonic
1065679839 10:28217866-28217888 TGCTTTTGATGTAGTCCAGCTGG - Intronic
1069832825 10:71291511-71291533 TTTTGTCGGTGGAGTCCTGCAGG - Exonic
1071324075 10:84494480-84494502 TCCTGGGAATGTAGTCCAGCTGG + Intronic
1084494287 11:69495150-69495172 TCCTGTCCATGCTTTCCTGCTGG - Intergenic
1085505028 11:77053510-77053532 TCCTGTGGATGCAGCCCAGCAGG - Intergenic
1090274545 11:125410276-125410298 TCATGGCGATGTTGCCCTGCTGG - Exonic
1097263150 12:57730938-57730960 TACTGTGGATGTAATCCTGGAGG + Exonic
1097835108 12:64265104-64265126 TCCTCTCGTTGTCATCCTGCGGG + Intronic
1113225028 13:108150247-108150269 TTCTGACGATGTAGTCCTTCGGG + Intergenic
1121866997 14:97371777-97371799 TCCCCTCCATGCAGTCCTGCTGG - Intergenic
1132204316 15:99976078-99976100 TCCTGTCGTTGCAGACCTCCTGG + Exonic
1132543134 16:520767-520789 TCCTGTCGATGTAGTCCTGCAGG - Exonic
1135157064 16:20061595-20061617 TCCTCTCAATGCAGTCCAGCAGG + Intronic
1145217448 17:21062529-21062551 TCTTGTCTATGTCTTCCTGCTGG - Intergenic
1161755030 19:6126587-6126609 TCCTCTGGAAGGAGTCCTGCTGG - Intronic
1166102247 19:40577550-40577572 CCCTGTCGATGAAGATCTGCGGG - Exonic
936082548 2:109444432-109444454 TCCTGTCCATATTCTCCTGCAGG - Intronic
1184876753 22:47281149-47281171 TCCAGTCCATGGAGTCCTGGGGG - Intergenic
954682553 3:52353564-52353586 TGCTCTCGATATGGTCCTGCAGG - Exonic
964237567 3:154550852-154550874 CCCTGTCAATTTAGTTCTGCTGG - Intergenic
966007751 3:175037204-175037226 TCATGTCAATGTTGTCCTGGAGG - Intronic
976246570 4:83011238-83011260 TCCTGTCAAAGTAGTTCTGCGGG - Intronic
978520399 4:109609586-109609608 TCCTGGGAATGTAGTCCAGCAGG + Intronic
980786602 4:137564088-137564110 TCCTCTCTATGTGGTTCTGCTGG - Intergenic
982181076 4:152748820-152748842 TCATGTCGAGGTGGGCCTGCAGG - Intronic
988919494 5:35927192-35927214 TCCTGTTGAGGAAGTCCTGCAGG + Intronic
993480072 5:88413708-88413730 TCCTGTCGAAGTATGTCTGCTGG + Intergenic
1008743724 6:54642733-54642755 TCCTGTGCATGTAGTGCTGTAGG + Intergenic
1025006614 7:55360563-55360585 TCCTGTCTATATGGTCCAGCTGG + Intergenic
1030856845 7:114568833-114568855 TCCTGTTTATGTACTCCTCCAGG + Intronic
1048051882 8:130825941-130825963 TCCTGCGGAAGTAGTCCTCCAGG - Intronic