ID: 1132543134

View in Genome Browser
Species Human (GRCh38)
Location 16:520767-520789
Sequence TCCTGTCGATGTAGTCCTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 30}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132543134_1132543136 -5 Left 1132543134 16:520767-520789 CCTGCAGGACTACATCGACAGGA 0: 1
1: 0
2: 0
3: 3
4: 30
Right 1132543136 16:520785-520807 CAGGATCATCGTGGCCATCATGG 0: 1
1: 0
2: 7
3: 411
4: 9908
1132543134_1132543144 30 Left 1132543134 16:520767-520789 CCTGCAGGACTACATCGACAGGA 0: 1
1: 0
2: 0
3: 3
4: 30
Right 1132543144 16:520820-520842 CCATCCTGGAGGTCAAGTAGAGG 0: 1
1: 0
2: 1
3: 10
4: 176
1132543134_1132543138 16 Left 1132543134 16:520767-520789 CCTGCAGGACTACATCGACAGGA 0: 1
1: 0
2: 0
3: 3
4: 30
Right 1132543138 16:520806-520828 GGAGACCAACCCGTCCATCCTGG 0: 1
1: 0
2: 1
3: 17
4: 872
1132543134_1132543139 19 Left 1132543134 16:520767-520789 CCTGCAGGACTACATCGACAGGA 0: 1
1: 0
2: 0
3: 3
4: 30
Right 1132543139 16:520809-520831 GACCAACCCGTCCATCCTGGAGG 0: 1
1: 0
2: 1
3: 7
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132543134 Original CRISPR TCCTGTCGATGTAGTCCTGC AGG (reversed) Exonic