ID: 1132543136 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:520785-520807 |
| Sequence | CAGGATCATCGTGGCCATCA TGG |
| Strand | + |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 10327 | |||
| Summary | {0: 1, 1: 0, 2: 7, 3: 411, 4: 9908} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1132543132_1132543136 | -2 | Left | 1132543132 | 16:520764-520786 | CCGCCTGCAGGACTACATCGACA | 0: 1 1: 0 2: 0 3: 4 4: 54 |
||
| Right | 1132543136 | 16:520785-520807 | CAGGATCATCGTGGCCATCATGG | 0: 1 1: 0 2: 7 3: 411 4: 9908 |
||||
| 1132543134_1132543136 | -5 | Left | 1132543134 | 16:520767-520789 | CCTGCAGGACTACATCGACAGGA | 0: 1 1: 0 2: 0 3: 3 4: 30 |
||
| Right | 1132543136 | 16:520785-520807 | CAGGATCATCGTGGCCATCATGG | 0: 1 1: 0 2: 7 3: 411 4: 9908 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1132543136 | Original CRISPR | CAGGATCATCGTGGCCATCA TGG | Exonic | ||