ID: 1132543136

View in Genome Browser
Species Human (GRCh38)
Location 16:520785-520807
Sequence CAGGATCATCGTGGCCATCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 10327
Summary {0: 1, 1: 0, 2: 7, 3: 411, 4: 9908}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132543132_1132543136 -2 Left 1132543132 16:520764-520786 CCGCCTGCAGGACTACATCGACA 0: 1
1: 0
2: 0
3: 4
4: 54
Right 1132543136 16:520785-520807 CAGGATCATCGTGGCCATCATGG 0: 1
1: 0
2: 7
3: 411
4: 9908
1132543134_1132543136 -5 Left 1132543134 16:520767-520789 CCTGCAGGACTACATCGACAGGA 0: 1
1: 0
2: 0
3: 3
4: 30
Right 1132543136 16:520785-520807 CAGGATCATCGTGGCCATCATGG 0: 1
1: 0
2: 7
3: 411
4: 9908

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132543136 Original CRISPR CAGGATCATCGTGGCCATCA TGG Exonic