ID: 1132543138

View in Genome Browser
Species Human (GRCh38)
Location 16:520806-520828
Sequence GGAGACCAACCCGTCCATCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 891
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 872}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132543132_1132543138 19 Left 1132543132 16:520764-520786 CCGCCTGCAGGACTACATCGACA 0: 1
1: 0
2: 0
3: 4
4: 54
Right 1132543138 16:520806-520828 GGAGACCAACCCGTCCATCCTGG 0: 1
1: 0
2: 1
3: 17
4: 872
1132543134_1132543138 16 Left 1132543134 16:520767-520789 CCTGCAGGACTACATCGACAGGA 0: 1
1: 0
2: 0
3: 3
4: 30
Right 1132543138 16:520806-520828 GGAGACCAACCCGTCCATCCTGG 0: 1
1: 0
2: 1
3: 17
4: 872

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132543138 Original CRISPR GGAGACCAACCCGTCCATCC TGG Exonic