ID: 1132543144

View in Genome Browser
Species Human (GRCh38)
Location 16:520820-520842
Sequence CCATCCTGGAGGTCAAGTAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 176}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132543134_1132543144 30 Left 1132543134 16:520767-520789 CCTGCAGGACTACATCGACAGGA 0: 1
1: 0
2: 0
3: 3
4: 30
Right 1132543144 16:520820-520842 CCATCCTGGAGGTCAAGTAGAGG 0: 1
1: 0
2: 1
3: 10
4: 176
1132543137_1132543144 -2 Left 1132543137 16:520799-520821 CCATCATGGAGACCAACCCGTCC 0: 1
1: 0
2: 0
3: 2
4: 69
Right 1132543144 16:520820-520842 CCATCCTGGAGGTCAAGTAGAGG 0: 1
1: 0
2: 1
3: 10
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132543144 Original CRISPR CCATCCTGGAGGTCAAGTAG AGG Exonic