ID: 1132543179

View in Genome Browser
Species Human (GRCh38)
Location 16:520984-521006
Sequence TTGGCAGCCCCGGTCTTTGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 85}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132543179_1132543191 5 Left 1132543179 16:520984-521006 CCGCCAAAGACCGGGGCTGCCAA 0: 1
1: 0
2: 0
3: 9
4: 85
Right 1132543191 16:521012-521034 CAGAGGGTGGTGGAGAGGAGAGG 0: 1
1: 2
2: 14
3: 181
4: 1514
1132543179_1132543190 0 Left 1132543179 16:520984-521006 CCGCCAAAGACCGGGGCTGCCAA 0: 1
1: 0
2: 0
3: 9
4: 85
Right 1132543190 16:521007-521029 AGGGGCAGAGGGTGGTGGAGAGG 0: 1
1: 0
2: 22
3: 247
4: 2229
1132543179_1132543187 -8 Left 1132543179 16:520984-521006 CCGCCAAAGACCGGGGCTGCCAA 0: 1
1: 0
2: 0
3: 9
4: 85
Right 1132543187 16:520999-521021 GCTGCCAAAGGGGCAGAGGGTGG 0: 1
1: 0
2: 3
3: 31
4: 467
1132543179_1132543196 25 Left 1132543179 16:520984-521006 CCGCCAAAGACCGGGGCTGCCAA 0: 1
1: 0
2: 0
3: 9
4: 85
Right 1132543196 16:521032-521054 AGGGAGAAAGGGAAGTCCCAGGG 0: 1
1: 2
2: 6
3: 53
4: 531
1132543179_1132543192 6 Left 1132543179 16:520984-521006 CCGCCAAAGACCGGGGCTGCCAA 0: 1
1: 0
2: 0
3: 9
4: 85
Right 1132543192 16:521013-521035 AGAGGGTGGTGGAGAGGAGAGGG 0: 2
1: 2
2: 28
3: 248
4: 2164
1132543179_1132543188 -5 Left 1132543179 16:520984-521006 CCGCCAAAGACCGGGGCTGCCAA 0: 1
1: 0
2: 0
3: 9
4: 85
Right 1132543188 16:521002-521024 GCCAAAGGGGCAGAGGGTGGTGG 0: 1
1: 1
2: 4
3: 79
4: 630
1132543179_1132543197 30 Left 1132543179 16:520984-521006 CCGCCAAAGACCGGGGCTGCCAA 0: 1
1: 0
2: 0
3: 9
4: 85
Right 1132543197 16:521037-521059 GAAAGGGAAGTCCCAGGGCCCGG 0: 1
1: 1
2: 2
3: 31
4: 468
1132543179_1132543194 14 Left 1132543179 16:520984-521006 CCGCCAAAGACCGGGGCTGCCAA 0: 1
1: 0
2: 0
3: 9
4: 85
Right 1132543194 16:521021-521043 GTGGAGAGGAGAGGGAGAAAGGG 0: 1
1: 0
2: 42
3: 404
4: 3104
1132543179_1132543195 24 Left 1132543179 16:520984-521006 CCGCCAAAGACCGGGGCTGCCAA 0: 1
1: 0
2: 0
3: 9
4: 85
Right 1132543195 16:521031-521053 GAGGGAGAAAGGGAAGTCCCAGG 0: 1
1: 1
2: 6
3: 71
4: 662
1132543179_1132543193 13 Left 1132543179 16:520984-521006 CCGCCAAAGACCGGGGCTGCCAA 0: 1
1: 0
2: 0
3: 9
4: 85
Right 1132543193 16:521020-521042 GGTGGAGAGGAGAGGGAGAAAGG 0: 1
1: 1
2: 46
3: 398
4: 2785

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132543179 Original CRISPR TTGGCAGCCCCGGTCTTTGG CGG (reversed) Exonic
900158856 1:1213996-1214018 GTGGCAGCACCGGTCGTTGCTGG + Exonic
910569645 1:88684818-88684840 GTGGCAGGCCAGGGCTTTGGCGG - Intronic
912738077 1:112167878-112167900 TTGGAAGCCCCAGTTTTTGGTGG - Intergenic
921080049 1:211732039-211732061 CTGGCAGCCCAGGGCTCTGGCGG - Intergenic
921481167 1:215666209-215666231 TTGGGAGGTCCGGTCTTTGGTGG - Intronic
924311684 1:242750552-242750574 TGGGAAGCCCTGGTCTCTGGAGG - Intergenic
1062826502 10:572823-572845 CTGGCTGCCCTGGTCTTTGAGGG - Intronic
1062919715 10:1270709-1270731 TGGGCATCCCCCGTCTCTGGGGG - Intronic
1069247946 10:66231038-66231060 GTGGCAGCTTGGGTCTTTGGAGG + Intronic
1069568592 10:69480184-69480206 GTGGCAGCTCTGGTGTTTGGGGG + Intronic
1070556463 10:77531700-77531722 TTGGAAGCCCTTTTCTTTGGTGG - Intronic
1074056447 10:109926532-109926554 TTGGCAGTCCTGGTGTTTGTTGG - Intergenic
1075440364 10:122475316-122475338 TTGGCAGCCCCTCTCTTTCCGGG - Intronic
1076463191 10:130660334-130660356 TGGGCAGCCGGGGGCTTTGGAGG - Intergenic
1083663825 11:64264223-64264245 TTGGCAGCCCTGGGATTTTGAGG + Intronic
1084938547 11:72600366-72600388 TTGGAAGCCCCAGTGCTTGGGGG - Intronic
1089307326 11:117534867-117534889 CTGGCATCCCAGCTCTTTGGAGG - Intronic
1101408969 12:104453701-104453723 ATGGCAGCGCCAGTCCTTGGAGG + Intergenic
1103469110 12:121165827-121165849 ATGGAAGCCACAGTCTTTGGGGG + Intronic
1104337433 12:127912670-127912692 TTGGCTGCCCAGGTTTTGGGGGG + Intergenic
1106185832 13:27408853-27408875 TTGGCAGCCCCGGTGTCTGTAGG - Intergenic
1118989837 14:70787862-70787884 GTAGCAGCCCAGGTGTTTGGTGG - Intronic
1120405915 14:84092671-84092693 TTGGCAGGTCCAGTTTTTGGTGG - Intergenic
1122389928 14:101373320-101373342 TGGGCAGCCCCGGCCTCTGCTGG - Intergenic
1130843483 15:87723422-87723444 GTGGCAGCCCTGGTCTTTCCTGG + Intergenic
1132543179 16:520984-521006 TTGGCAGCCCCGGTCTTTGGCGG - Exonic
1132605493 16:792147-792169 GCGGCAGCCCCGGCCTTGGGAGG + Intronic
1134803060 16:17103453-17103475 TTGGCAGCCCCTTCCTTAGGAGG + Exonic
1136364333 16:29802371-29802393 TTGGCAGCTGAGGTCTTCGGTGG + Intronic
1138557026 16:57776807-57776829 GTGGCAGCTCCTGCCTTTGGTGG - Intronic
1138757352 16:59504554-59504576 TCGGCACCCCCAGCCTTTGGGGG + Intergenic
1140536084 16:75711371-75711393 TTGGCAGCCCAAGTCTTAGCAGG + Intronic
1141572176 16:84940842-84940864 TTGCCAGCCTCGGCCTGTGGGGG + Intergenic
1142170881 16:88622210-88622232 GTGGCAGCCTCCTTCTTTGGTGG - Exonic
1142794543 17:2297407-2297429 TTGTCTGCCCCGGTTTTTGGTGG - Intronic
1143478832 17:7217428-7217450 CTGGCAGCCCCGGAGTTCGGGGG + Intronic
1144734419 17:17547001-17547023 TGGGCAGCCCAGCTCTTCGGGGG - Intronic
1145910072 17:28537278-28537300 TTGGCAGCCCCGGGCAGTGGTGG + Exonic
1145998607 17:29118331-29118353 TTGCCAGCCCTGGGCCTTGGGGG - Intronic
1147652706 17:42071460-42071482 GAGCCAGCCCCTGTCTTTGGGGG - Intergenic
1148480527 17:47957062-47957084 CTGCCACCCCCTGTCTTTGGTGG + Intronic
1153799260 18:8655238-8655260 TTGGCTACCCCTGTCTTTTGTGG - Intergenic
1155257774 18:24014153-24014175 TTGGCTGCCCTGGTCCTAGGGGG + Intronic
1156419225 18:36933274-36933296 TTTGCAGCCCTGCTCTGTGGTGG + Intronic
1157223285 18:45841904-45841926 TGGGCTGCCCTGGCCTTTGGGGG + Intronic
1157330038 18:46697043-46697065 TTGGCTGCCATGGTTTTTGGTGG - Intronic
1160153547 18:76413634-76413656 GTGGCAGCCCAGATATTTGGGGG - Intronic
1161380837 19:3964205-3964227 TGGGCAGCCCCGGCCTGGGGAGG - Intronic
1164572556 19:29384990-29385012 TTTGAAGCCCCGCTCTGTGGGGG + Intergenic
1166763467 19:45238778-45238800 TGGGCAGCCCCGCTCTTTCTTGG - Intronic
928029450 2:27766231-27766253 CTGACAGCATCGGTCTTTGGGGG - Intergenic
934521850 2:95024949-95024971 TGGGCAGCCCGGGCCTTTTGAGG - Intergenic
938775299 2:134536487-134536509 AAGGCAGCCCCGGGCTCTGGAGG + Intronic
946147679 2:217743241-217743263 TTGGCAGCCTAGGTCTCTGCGGG + Intronic
1173760525 20:45555759-45555781 TTCGCAGCCCCTGTATTTGAAGG + Exonic
1175551420 20:59820343-59820365 TTGCCTGCCCCGGCCTTTGCAGG - Intronic
1176059465 20:63166060-63166082 TGGGCAGCCCCGGCCTCTGGTGG - Intergenic
1180707523 22:17818484-17818506 TTGGCAGGCCCAGCCTTTTGGGG + Exonic
1180791442 22:18577572-18577594 CTGGCAGGCCCGGGCTTTGTGGG - Intergenic
1181230297 22:21417739-21417761 CTGGCAGGCCCGGGCTTTGTGGG + Intronic
1181248353 22:21517124-21517146 CTGGCAGGCCCGGGCTTTGTGGG - Intergenic
1182257323 22:29048611-29048633 CTGGCAGCCCTGGGTTTTGGAGG + Intronic
1184916919 22:47575566-47575588 TGGGCAGCCCCGCTCTTCTGGGG + Intergenic
952722414 3:36546933-36546955 TAGGCAGGTCAGGTCTTTGGAGG - Exonic
953374495 3:42417257-42417279 GTGGCAGCCCTGGGCCTTGGAGG + Intergenic
954263950 3:49459309-49459331 TAGGCAGCCCACGTCTGTGGTGG + Intergenic
956062266 3:65359522-65359544 TTAACTGCCGCGGTCTTTGGTGG - Intronic
959862198 3:111229260-111229282 TTTGCAGCCCAGTCCTTTGGTGG + Intronic
965184766 3:165448593-165448615 TTGGAAGCTCCAGTGTTTGGTGG - Intergenic
968038822 3:195571463-195571485 TTGGCTGCCACGGTCCTTAGTGG - Intronic
981124988 4:141095305-141095327 TTGCCTGCCCCGGTCTTCTGGGG - Intronic
981698932 4:147586722-147586744 TTGGCAGCCCCCGAGTCTGGAGG + Intergenic
983557675 4:169072816-169072838 ATCACAGCCCTGGTCTTTGGAGG - Intergenic
994773705 5:104016761-104016783 TTGGTATCCACGGTCTGTGGGGG - Intergenic
997953110 5:138257740-138257762 CCCGCAGCCCCGGTCGTTGGGGG + Exonic
998486319 5:142505550-142505572 ATGGCAGCCTCAGTCTTTGGAGG + Intergenic
1007667379 6:43523208-43523230 TTCCCAGCCCTGGTCCTTGGAGG + Exonic
1019016582 6:168884848-168884870 CAGGCAGCCCCGGCCCTTGGCGG - Intergenic
1019578079 7:1747085-1747107 TGGGCATCGCCGGTCTTGGGGGG - Exonic
1019777516 7:2921412-2921434 TGCGCAGCTCCGGGCTTTGGAGG + Intronic
1020201815 7:6085972-6085994 TTGGCAGCCAGTGTCTGTGGTGG - Intergenic
1021531483 7:21651064-21651086 TGGGCAGCCCTGGTCTTTTGTGG - Intronic
1026646543 7:72175674-72175696 TAGGCAGACCAGGGCTTTGGAGG + Intronic
1028197706 7:87926670-87926692 TTGTCAGCCCTGGTCACTGGCGG + Intergenic
1034265097 7:149776936-149776958 TTGGCAGGCCGGGTTTCTGGAGG - Intergenic
1034461734 7:151201251-151201273 ATGGCAGGCCTGGTCTGTGGTGG - Intronic
1036670135 8:10778099-10778121 TTAGAAACCCTGGTCTTTGGGGG + Intronic
1056811832 9:89771124-89771146 TTGGCAGCCCCTCTCCTGGGTGG + Intergenic
1061010938 9:127954281-127954303 TTGGCAGAGCCTGGCTTTGGAGG - Intronic
1061800846 9:133112742-133112764 TTGGCAGCCCAGGTCTGGGCAGG + Intronic
1192202981 X:69078591-69078613 TGGGCAGCCCCTGCCTCTGGAGG - Intergenic
1195992244 X:110694099-110694121 TCAGCAGCCCTGGTCTTTGCAGG - Intronic
1198433724 X:136593762-136593784 TTTGCAGCTCCATTCTTTGGTGG + Intergenic
1199618941 X:149682058-149682080 TTGGCAGCCACAGTCTTGGGAGG + Intergenic
1200124375 X:153806351-153806373 TGGTCAGCCCCGGGCATTGGTGG + Intronic