ID: 1132544544

View in Genome Browser
Species Human (GRCh38)
Location 16:527343-527365
Sequence TCCGTGTCCCGCGGGGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 67}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132544544_1132544550 -9 Left 1132544544 16:527343-527365 CCCAGAGCCCCGCGGGACACGGA 0: 1
1: 0
2: 0
3: 8
4: 67
Right 1132544550 16:527357-527379 GGACACGGACGGCCCCAGCCCGG 0: 1
1: 0
2: 1
3: 17
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132544544 Original CRISPR TCCGTGTCCCGCGGGGCTCT GGG (reversed) Intergenic