ID: 1132544544

View in Genome Browser
Species Human (GRCh38)
Location 16:527343-527365
Sequence TCCGTGTCCCGCGGGGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 67}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132544544_1132544550 -9 Left 1132544544 16:527343-527365 CCCAGAGCCCCGCGGGACACGGA 0: 1
1: 0
2: 0
3: 8
4: 67
Right 1132544550 16:527357-527379 GGACACGGACGGCCCCAGCCCGG 0: 1
1: 0
2: 1
3: 17
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132544544 Original CRISPR TCCGTGTCCCGCGGGGCTCT GGG (reversed) Intergenic
900421601 1:2558199-2558221 GCTGTGTCCCGTGGGGCTCATGG + Intronic
905456861 1:38094376-38094398 TCCAAGTCCCACGTGGCTCTGGG + Intergenic
905846832 1:41241392-41241414 CCCGTTTCCGGCGGGGCACTGGG + Intronic
920807201 1:209246010-209246032 TCCCTGTTCCTCGGGGCTCCTGG - Intergenic
922558154 1:226548762-226548784 TCCGTGCGCCGCGCGGCTCGCGG - Intergenic
1064278994 10:13933765-13933787 TCTGTGTCCCAGGGGCCTCTAGG - Intronic
1073207296 10:101775920-101775942 GGCGTGACCCGCCGGGCTCTCGG - Exonic
1073446562 10:103584495-103584517 GCAGTGTCACGCAGGGCTCTCGG - Intronic
1076827742 10:132978061-132978083 TCCGTGTCCCGCGTCTCTGTGGG - Intergenic
1077079805 11:720230-720252 TCCCTGTCCCCCGTGGCGCTGGG - Intronic
1077143026 11:1033195-1033217 TCCATGGCCCGTGGGGCTCGAGG + Intronic
1077212078 11:1375717-1375739 TCCGGGTCCTGCTGGGTTCTTGG + Intergenic
1077323542 11:1953407-1953429 TACGTATCCTGGGGGGCTCTGGG + Intronic
1083389487 11:62337553-62337575 TCCGCGTCCTGCGGTGCCCTGGG + Exonic
1083745762 11:64735710-64735732 TCTCTGTTCCCCGGGGCTCTGGG - Intronic
1084182280 11:67452733-67452755 TCCGTGTCCAGCAGGACTCTGGG - Intronic
1085637407 11:78169221-78169243 CCTGTGTCCCAGGGGGCTCTGGG - Intergenic
1202806529 11_KI270721v1_random:8602-8624 TACGTATCCTGGGGGGCTCTGGG + Intergenic
1105943468 13:25170874-25170896 TCCGGCTCGCGCGCGGCTCTGGG + Exonic
1112802646 13:103129633-103129655 TCAGTGGCCCCCTGGGCTCTTGG + Intergenic
1113719812 13:112546691-112546713 TCTGTGTCCAGCGGGCCCCTGGG - Intronic
1117524059 14:56579855-56579877 TCCGTGTCGCACCGGGTTCTTGG + Exonic
1121613811 14:95299396-95299418 TGCGTGTCCCGTGGGGCTGGAGG - Intronic
1124848280 15:33311758-33311780 TCCCTGTCCTGCGGGGCTCGCGG - Intronic
1127932948 15:63609435-63609457 CCCGTGGCCCTCGAGGCTCTGGG + Intronic
1132544544 16:527343-527365 TCCGTGTCCCGCGGGGCTCTGGG - Intergenic
1132826143 16:1906649-1906671 TTCGTGTCCTCAGGGGCTCTCGG - Intergenic
1134225297 16:12385437-12385459 ATTGTGTCCCGCAGGGCTCTAGG + Intronic
1138179784 16:54933345-54933367 TCCGGGTCCCGGCGGGCCCTCGG + Exonic
1140224474 16:73066872-73066894 TCCGTATCCCGCGGGGCTGGGGG - Intergenic
1140953178 16:79838503-79838525 TACGTGTTTTGCGGGGCTCTTGG - Intergenic
1141425203 16:83940372-83940394 TCCTTGTCCTGCTGGGCTCTGGG + Intronic
1144581232 17:16460604-16460626 CCTGTGTCCCGCCCGGCTCTGGG + Intronic
1145963716 17:28902527-28902549 TCTGTGTCCCGGCGGGTTCTCGG + Intronic
1146482932 17:33219627-33219649 ACTGTGTCCTGCGGGACTCTGGG + Intronic
1152223405 17:79081707-79081729 GCCCTGTCCCTCTGGGCTCTAGG + Intronic
1152543511 17:80989250-80989272 TTCGTGACCTGCGGGCCTCTGGG - Intergenic
1152824969 17:82458865-82458887 TGCTTGTCCTGTGGGGCTCTGGG + Intronic
1155219539 18:23671791-23671813 TCAGTGTCCCAGGGGGATCTGGG + Intergenic
1160415247 18:78705395-78705417 CCCGTGGCCCGAGGGGCCCTGGG - Intergenic
1160858409 19:1227523-1227545 TCCGCCTCCCGCGGGCCCCTGGG - Intronic
1166471605 19:43083509-43083531 GCCATGTCCCGCGGGGTTCCTGG - Intronic
1166482749 19:43187325-43187347 GCCATGTCCCGCGGGGTTCCTGG - Intronic
1166485223 19:43206459-43206481 GCCATGTCCCGCGGGGTTCCTGG - Intronic
1166492373 19:43270377-43270399 GCCATGTCCCGCGGGGTTCCTGG - Intergenic
1167816588 19:51887730-51887752 TCCGTGTTGCGGGGAGCTCTCGG - Intronic
932298219 2:70644307-70644329 TCCATGTCCTGCTGGGTTCTAGG + Intronic
1175715745 20:61253193-61253215 TGCGTGTCCGGCGGGGCCCCGGG + Intronic
1175736653 20:61391881-61391903 TCCGGGGCCTGCAGGGCTCTGGG + Intronic
1175820107 20:61904502-61904524 ACCGTGTCCCCCTGGTCTCTCGG + Intronic
953657047 3:44862191-44862213 TGCGGGGCCCGCGGGGCTCTTGG + Intronic
961537076 3:127576797-127576819 TGTGTGTACCGCTGGGCTCTTGG - Intronic
961675210 3:128560841-128560863 TCTCTGTCCTGGGGGGCTCTGGG - Intergenic
963733067 3:148991420-148991442 GCGGTGGCCCGCGGGGCTCCGGG - Exonic
966696338 3:182793721-182793743 TCCGGGTCCCGCGGGGCGCGGGG - Exonic
966809147 3:183827969-183827991 TCCCTGGCCCGTGGGCCTCTTGG - Intergenic
968593731 4:1472205-1472227 CCCGTGTCCCGCGGGGCAGCCGG + Intergenic
969790251 4:9489452-9489474 TCTGTGTCCTGGGGGGCTCAAGG - Intergenic
998152299 5:139764447-139764469 TCCGTGTCCCGGGGGTCTGGCGG + Intergenic
1002452390 5:179326302-179326324 GCCATGTCCTGAGGGGCTCTCGG + Intronic
1006580915 6:35077492-35077514 TCTGTGCCCAGCGGGGCTCTGGG + Intronic
1010141510 6:72620198-72620220 TCAGGGTCCCGCGCAGCTCTAGG + Intergenic
1011228859 6:85137510-85137532 TGCCTGTCCCGCGGAGCCCTAGG - Intergenic
1017662394 6:156687338-156687360 TCCGGGTCCCGGGCGGCTCCGGG + Intergenic
1021279795 7:18703766-18703788 TCCCTGTCCCCCAGGGCCCTGGG + Intronic
1029869962 7:103680333-103680355 TCTGAGTCCCCAGGGGCTCTGGG + Intronic
1034498125 7:151433936-151433958 CCCGTGTCCTGGTGGGCTCTCGG - Intronic
1049777558 8:144413634-144413656 TCCGCCTCCCGCGGTGATCTGGG - Intronic
1060051880 9:120383712-120383734 TCGGGGGCCCGCGGGGCTCTGGG + Intergenic
1061042121 9:128146316-128146338 TCCCTGGACCCCGGGGCTCTTGG - Intergenic
1062611268 9:137374746-137374768 TCTCTGTCCCTCGGGACTCTGGG + Intronic
1203781520 EBV:103677-103699 TCCGTGTCCCCCCGGGCTGATGG - Intergenic
1187823813 X:23315104-23315126 TCCGTGGCCCTCTGAGCTCTGGG + Intergenic
1196303625 X:114074188-114074210 TCTGTTTCCCGAGGGGCACTGGG - Intergenic
1196339469 X:114581322-114581344 ACCGTGTTCCGGGGGGCACTGGG + Intergenic
1199793539 X:151176046-151176068 TCTGTGTCCCGCGGGGAACAGGG - Intergenic