ID: 1132547660

View in Genome Browser
Species Human (GRCh38)
Location 16:540663-540685
Sequence CTGGGGTCGCTGGCGGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 291}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132547651_1132547660 14 Left 1132547651 16:540626-540648 CCACGCAGAGAAGCTGTTCCTGA 0: 1
1: 0
2: 0
3: 15
4: 178
Right 1132547660 16:540663-540685 CTGGGGTCGCTGGCGGCTGCAGG 0: 1
1: 0
2: 3
3: 20
4: 291
1132547654_1132547660 -4 Left 1132547654 16:540644-540666 CCTGAAGCTTCTTTTTGGGCTGG 0: 1
1: 0
2: 1
3: 12
4: 184
Right 1132547660 16:540663-540685 CTGGGGTCGCTGGCGGCTGCAGG 0: 1
1: 0
2: 3
3: 20
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132547660 Original CRISPR CTGGGGTCGCTGGCGGCTGC AGG Intronic
900547289 1:3236079-3236101 CTGGGGAGGGTGGCGCCTGCAGG - Intronic
900617903 1:3573529-3573551 CTGGGGCTGCTGCAGGCTGCAGG + Intronic
900633559 1:3651312-3651334 CTGGGTTCTCTGGCCGCAGCGGG - Intronic
901208154 1:7509038-7509060 CTGGGCTCCCTGGCTGCTGTGGG + Intronic
901629732 1:10642230-10642252 ATGGAGTCGCTGGCGGCTGCGGG + Intronic
901660310 1:10794904-10794926 CTGGGGCCGCTGGCGGGGGCTGG - Intronic
903510898 1:23874232-23874254 CTGTGGTCTCTGGAGGATGCAGG + Exonic
904966842 1:34380760-34380782 CTGGGGTCACTGGGGGCAACTGG - Intergenic
905394278 1:37657251-37657273 CTGGGGTCCCTGAGGGCTGGGGG - Intergenic
905474668 1:38217704-38217726 CTGGGGTCCCTGGAGCCTGCAGG + Intergenic
906678720 1:47710685-47710707 CCGGAGGCGCAGGCGGCTGCTGG + Intergenic
908355886 1:63324251-63324273 CTGGGGTCGCCGGCGGCACTGGG + Exonic
908780649 1:67686336-67686358 TCGGGGTCGCTGGGGGCAGCGGG - Exonic
908816806 1:68043375-68043397 CTGTGGTGGCTGGAGGCTTCAGG - Intergenic
910338226 1:86156686-86156708 CTCGGGGCGCCGGCGGCAGCGGG + Exonic
914855538 1:151347507-151347529 CTGGGGTCGGTTGGGACTGCAGG + Intergenic
914944096 1:152048350-152048372 CTGGAGTGGCTAGAGGCTGCTGG + Intergenic
915225056 1:154405742-154405764 CTGGGGCAGCTAGCGGCTGGGGG + Intronic
915551513 1:156638115-156638137 ATGGGGACGCTGGCTCCTGCTGG + Intergenic
916056937 1:161074407-161074429 CTGGGGTGGGTTGTGGCTGCAGG - Intronic
917310066 1:173669617-173669639 CTGCGATCCCTTGCGGCTGCCGG + Intronic
918048075 1:180953367-180953389 CTGGGGCCCCTTGAGGCTGCGGG - Intergenic
918388852 1:184037415-184037437 CTGAGGGCGGCGGCGGCTGCCGG + Exonic
920534579 1:206729268-206729290 CTGGGGTGGGTGGTGGCTGTGGG + Intronic
920704736 1:208243161-208243183 CCGGGGTCCCTGGTGGCCGCCGG - Intronic
921664359 1:217850004-217850026 TTGGGGTCGCTGCTGTCTGCTGG + Intronic
922335731 1:224616976-224616998 CTGGGGTCGCCGGAGCCTGCGGG + Exonic
922554705 1:226523845-226523867 CTGGGGTGGCCTGCGGATGCAGG + Intergenic
922573943 1:226650143-226650165 CAGGGGTCAGCGGCGGCTGCTGG + Intronic
923630249 1:235644972-235644994 CTGGGGTCTCTGGCGGCCCGGGG - Intronic
1063666183 10:8062009-8062031 TTTGTGTCGCTGGTGGCTGCTGG - Intronic
1064111817 10:12546201-12546223 GTGGGCTCGCTGGGGGCTACGGG + Intronic
1066402608 10:35090355-35090377 CCGGGGCCGGTGGCGGCGGCCGG - Exonic
1066406902 10:35127064-35127086 GTGGGGCCGCTGCCGGCTCCGGG + Intronic
1067078487 10:43201288-43201310 CTGGGGTCCCTGGCTCCTCCTGG + Intronic
1067469095 10:46523362-46523384 CTGGGGTCTCGGGCATCTGCAGG + Intergenic
1067858449 10:49818957-49818979 CTGGCATCGCTGGCATCTGCGGG + Intronic
1068763981 10:60742786-60742808 CTGGTGTGGCTGGGGCCTGCAGG - Intergenic
1069749542 10:70736492-70736514 GAGGGGTCCCTGGAGGCTGCCGG + Intronic
1070032620 10:72692210-72692232 GCGGGGGCGCCGGCGGCTGCGGG + Exonic
1070490843 10:76975101-76975123 CTGGTGTCGCTGACGGCCGAAGG - Intronic
1070570861 10:77638448-77638470 CTGCTGCTGCTGGCGGCTGCGGG - Intronic
1073452212 10:103616725-103616747 CTGGGGGCGGGGGCGGGTGCAGG - Intronic
1074881262 10:117661325-117661347 CTGTGGGCTGTGGCGGCTGCAGG + Intergenic
1075588643 10:123675898-123675920 CTGAGGATGCTGGGGGCTGCTGG - Intronic
1075709217 10:124521700-124521722 CTGGGGCAGCTGGCGGGTGGGGG + Intronic
1075941579 10:126394726-126394748 CTGGGGTGGATGGAGGCTGGGGG + Intergenic
1076079259 10:127563908-127563930 CTGGGCCCTCTGGCAGCTGCTGG + Intergenic
1076163377 10:128263149-128263171 CTGGGGTCGCAGGTGGGAGCTGG + Intergenic
1076343446 10:129765361-129765383 CTGGGGGCTCTGGGGGCTCCAGG - Intronic
1076648427 10:131970450-131970472 CTGGGGCCTTTGGGGGCTGCAGG + Intronic
1077085253 11:747044-747066 CTGGGGTCGGGGGCCGCTGCAGG - Intergenic
1077117028 11:889843-889865 CTGTGGCCGCTGGCTGCTGGGGG - Intronic
1077281881 11:1749565-1749587 CGGGGGTCCCTGGAGGCAGCAGG - Intronic
1078060835 11:8041880-8041902 GGGGGCTCGCTGGAGGCTGCGGG - Intronic
1081364890 11:42222486-42222508 CTGGGCTCGTTGGGGGCTGGGGG + Intergenic
1081928000 11:46846438-46846460 GTGGGGACGCTGGTCGCTGCCGG + Intergenic
1082174928 11:49048690-49048712 GTGGGGTCGGTGGGGGCGGCAGG - Intergenic
1083048275 11:59755469-59755491 CTGGAGGCGCAGGCGGCGGCGGG - Exonic
1083294789 11:61709557-61709579 CTGGGGTCCCTGAGGGCTTCTGG + Intronic
1083829739 11:65224021-65224043 CTGGGGCTGCTGACGGCTTCAGG + Intergenic
1083891967 11:65599996-65600018 CTGGGGTCGCTGGCTGCCATTGG - Intronic
1084043513 11:66556022-66556044 CTTGGGTGGCTGGCTGCTGGTGG + Intronic
1084153412 11:67301710-67301732 CTGTGGGCTCTGGTGGCTGCAGG + Exonic
1084356461 11:68641910-68641932 CTGGGGGAGCTGGCAGCTGGGGG - Intergenic
1084543497 11:69801705-69801727 CTGAGGTCGCTGCCATCTGCTGG + Intergenic
1084672013 11:70612625-70612647 CGGGGGCCGCTGGGGGCTTCTGG - Intronic
1085445434 11:76597919-76597941 CTGGGTTCCCTGACTGCTGCTGG - Intergenic
1085945456 11:81265757-81265779 CTGGGGTTGGTGGCTGCTGATGG + Intergenic
1086690846 11:89787396-89787418 GTGGGGTCGGTGGGGGCGGCAGG + Intergenic
1086714954 11:90052259-90052281 GTGGGGTCGGTGGGGGCGGCAGG - Intergenic
1088850442 11:113699615-113699637 CTGGGGCTGCTGGCCGGTGCAGG - Exonic
1089196732 11:116697887-116697909 CTGGGGCTGCTGGAGGCTGCTGG - Intergenic
1089616786 11:119699379-119699401 CTGGGCTAGTTGGCGTCTGCTGG - Intronic
1089747636 11:120628341-120628363 CAGGGGTGGCTGGGGGCTCCTGG - Intronic
1091259760 11:134224909-134224931 CGGGGGAGGCTGGCGGCTGCGGG - Exonic
1094377113 12:29801964-29801986 CTGGGGGCGCTGCAGGCGGCCGG + Intergenic
1094498905 12:31006278-31006300 CTGGGGTGGTTGGCGACTTCTGG - Intergenic
1100616460 12:96235197-96235219 CTGGGGTGGGGGGCGGCTGTGGG - Intronic
1101131817 12:101697825-101697847 CTGCGCTCGGTGGCGGCGGCGGG + Exonic
1102344756 12:112152464-112152486 CTGCGGTAGTTGGCAGCTGCAGG - Exonic
1102572483 12:113835538-113835560 CCGGGGTCAGTGGGGGCTGCCGG + Intronic
1103222239 12:119255473-119255495 CTGGGGTCCCAGGGGACTGCTGG - Intergenic
1104767658 12:131340876-131340898 CTAGGGTCTCTGTCGGCTGTAGG - Intergenic
1104812052 12:131625206-131625228 CTAGGGTCTCTGTCGGCTTCAGG + Intergenic
1104929221 12:132329410-132329432 CTGGGGTCGCGGGGCGCGGCCGG + Intergenic
1104936654 12:132368046-132368068 CTGGGGTCGCTGGGGGTCTCTGG - Intergenic
1105214787 13:18277818-18277840 CTGGGACCGCTGCAGGCTGCAGG + Intergenic
1106761883 13:32875749-32875771 CTAGGGTTGCTGGCTGCTGCTGG + Intergenic
1109829060 13:67761815-67761837 TTGGGGTTGTTTGCGGCTGCTGG + Intergenic
1110552552 13:76825489-76825511 CTGGGGTCGGTGGGGGCTGGGGG - Intergenic
1110573050 13:77026868-77026890 CCGGGGACGGCGGCGGCTGCAGG + Exonic
1113831267 13:113297445-113297467 CAGGGGTCGCCGGGCGCTGCCGG - Exonic
1114551308 14:23534259-23534281 CTGGGGTCCCAGGTGGCTGTGGG + Exonic
1114616008 14:24068835-24068857 CTGGGGAGGCTGGCGGCCCCTGG - Exonic
1118332798 14:64826826-64826848 CTGGGGTCGGTGGTGGCAGAAGG - Intronic
1118463909 14:66013747-66013769 CGGGGGCGGCGGGCGGCTGCTGG + Intergenic
1118994186 14:70822058-70822080 CTGCGGTCACTCGCGGCTTCGGG + Intergenic
1119484894 14:74980847-74980869 CTGCAGACCCTGGCGGCTGCCGG + Intergenic
1120449989 14:84655165-84655187 CTGGGGTAAGTGGCGGCTGGGGG - Intergenic
1121754473 14:96391761-96391783 CTGCGCGCGCTGTCGGCTGCTGG - Intergenic
1122188337 14:100019486-100019508 CTGGCGGAGCTGGAGGCTGCAGG + Intronic
1122817766 14:104321936-104321958 CTGGGGGCGGGGGCGGCTGGAGG + Intergenic
1202902249 14_GL000194v1_random:50617-50639 GAGGGGTTGCTGGGGGCTGCTGG - Intergenic
1124475350 15:30028414-30028436 CTGGGGTCCCAGTGGGCTGCAGG + Intergenic
1126048141 15:44663466-44663488 CTGGGGAGCCTGACGGCTGCGGG - Exonic
1127546699 15:59999674-59999696 CAGGGGTCGCTGGCGGGGGTAGG + Intergenic
1128344001 15:66842485-66842507 CTCGGCTCGCAGGCGGCCGCCGG - Intergenic
1128392172 15:67189674-67189696 CTGGAGTCGCTGGTGCCAGCTGG - Intronic
1129320526 15:74772208-74772230 TTGGAGTCGCTGAGGGCTGCAGG + Intergenic
1131525010 15:93145745-93145767 CTGGGGTTGCAGGTGGCTGGAGG + Intergenic
1131999566 15:98165139-98165161 CTGGGGTCTTTAGCAGCTGCAGG - Intergenic
1132547660 16:540663-540685 CTGGGGTCGCTGGCGGCTGCAGG + Intronic
1132887495 16:2189081-2189103 TTGGGGTCGGTGGCGTCTCCCGG + Exonic
1133008255 16:2896537-2896559 CTGGGCTTCCTGGGGGCTGCCGG - Exonic
1133013819 16:2929773-2929795 CTGGGCTTCCTGGGGGCTGCCGG - Exonic
1133020837 16:2966363-2966385 CTGGGGCCGCTGAGGGCTGGGGG - Exonic
1133087278 16:3374804-3374826 CTGGGGCCTCTGGTGGCTGCTGG - Intronic
1135400382 16:22162655-22162677 CTGGGCTCGCGGGCAGCTCCAGG - Intergenic
1136220179 16:28823434-28823456 CTGGGGCCTGTGGCCGCTGCCGG + Exonic
1136610851 16:31364039-31364061 TTGGGGTGGAGGGCGGCTGCAGG - Intronic
1138433368 16:56983473-56983495 CTGGGGTGACTGGGGGCTGTTGG + Intronic
1139949911 16:70663765-70663787 GGGGGGTCGCTGGTGGCGGCTGG + Exonic
1140223105 16:73058178-73058200 CGGGGGTCGCCGGCGGCCGGCGG + Intronic
1141690086 16:85591626-85591648 CTGGGGGTGCTGGGGGCTCCTGG + Intergenic
1141703980 16:85654787-85654809 CACGGGCCGCTGGAGGCTGCAGG - Exonic
1141961715 16:87413413-87413435 CTGGGGTTGATGGCGGGGGCCGG - Intronic
1142237369 16:88928569-88928591 CCGGGGTCGCCGGCTGCTTCAGG - Intronic
1142557582 17:790243-790265 CAGGCGTCGCAGGCTGCTGCCGG + Intronic
1142694745 17:1627679-1627701 CTGGGGTTGCGGGGGGCTCCTGG - Intronic
1142866463 17:2794483-2794505 CTGGGGTGGCTTCAGGCTGCTGG - Intronic
1143497837 17:7322614-7322636 CTGGGGTAGCTGCCGGCTCCAGG - Intronic
1143648467 17:8247895-8247917 CTGGGCTCGCTGGCCGCGTCCGG - Intronic
1144339777 17:14301788-14301810 GTGGGGTGGCTGGCGGCGCCCGG - Exonic
1146371133 17:32266153-32266175 CCGGGGGCGGCGGCGGCTGCGGG - Intergenic
1147152811 17:38528104-38528126 TTGGGGGCGCTGGTGGCTGAGGG - Intergenic
1148135625 17:45290010-45290032 CTGGGGCGGCAGGCTGCTGCAGG - Intronic
1148388564 17:47253910-47253932 CTGGGGGCGCTGGCGGGCGTTGG + Exonic
1148547842 17:48530688-48530710 CCAGGGTCGAAGGCGGCTGCTGG + Exonic
1150653901 17:67027230-67027252 CTGGGGGCACGGGCAGCTGCAGG - Intronic
1151323502 17:73365380-73365402 CTGGGAGCGCTGGGGGCTGCGGG + Exonic
1151932658 17:77242276-77242298 CTGGGGTGGCTGGCGCCGCCTGG + Intergenic
1151993170 17:77591659-77591681 CTGGGGACACTGCAGGCTGCTGG + Intergenic
1152723663 17:81934893-81934915 CGGGGGAAGCTGGCGGCGGCGGG - Intronic
1152727728 17:81955911-81955933 CTGGGGTCGGGGGCAGCAGCGGG - Intronic
1154992784 18:21612209-21612231 CTGCGGCCCCTGGCGGCTGGAGG - Intergenic
1155492056 18:26408957-26408979 CTGGGGTGGGTGGCGGGTGTGGG + Intergenic
1157248195 18:46071862-46071884 CTGGGGGCGCGGGCGGCAGAGGG + Intronic
1158849110 18:61476336-61476358 CTGGTGCCACTGGGGGCTGCCGG - Intronic
1160378281 18:78429993-78430015 CTGGGGTGGGTGGCGGGAGCGGG + Intergenic
1160571281 18:79819215-79819237 CTGGTGTCTCTGCAGGCTGCCGG - Intergenic
1160874055 19:1289085-1289107 CTGGAGTCGCATCCGGCTGCAGG + Intronic
1160967894 19:1754521-1754543 CTGGGCGGGCTGGCGGCGGCCGG + Exonic
1161404582 19:4084334-4084356 GTGGGGCCGCCGGCCGCTGCTGG + Intergenic
1162152785 19:8657431-8657453 TTGGGGACTCTGGCTGCTGCAGG + Intergenic
1162345056 19:10114023-10114045 CTTGGGTCGCAGGTGGCTTCGGG - Exonic
1162481528 19:10929423-10929445 CGTGGGTCGCTGGTGGGTGCTGG + Exonic
1162721675 19:12666565-12666587 CTTTTGTTGCTGGCGGCTGCCGG - Exonic
1162986999 19:14277330-14277352 CTGGGGTTGCTGGCGGGTTTGGG + Intergenic
1163153663 19:15428805-15428827 TTGGGGGCGATGGTGGCTGCTGG + Intronic
1163302942 19:16459207-16459229 TTGGGGCCGCTGCCTGCTGCAGG + Intronic
1163372729 19:16910888-16910910 CTGGGGTCCCTGGAAGCTGGAGG + Intronic
1164457585 19:28421451-28421473 CCGAGGTAGCTGGGGGCTGCTGG - Intergenic
1165247309 19:34505005-34505027 CTGGGCTGGGTGGAGGCTGCAGG - Exonic
1165352242 19:35282122-35282144 CTGAGGAGCCTGGCGGCTGCTGG + Intronic
1165914154 19:39247727-39247749 CTGGAGCTGCTGGCGGCCGCGGG - Intergenic
1165951044 19:39474095-39474117 CCGGCGTCCCTGGCGTCTGCGGG - Exonic
1166209707 19:41298435-41298457 CTGTGGTCGCTGGGGGCTGCTGG - Intronic
1166777055 19:45319464-45319486 ATGGGGGCTCTGGAGGCTGCCGG - Intronic
1166854721 19:45777851-45777873 GTGCGGTCGCTGGTGGCTGTGGG - Exonic
1167455991 19:49596926-49596948 CTCGGGTCGCAGGCGGGGGCTGG - Exonic
1167494592 19:49810154-49810176 CTGGGGGAGGTGGAGGCTGCCGG + Intronic
1168246395 19:55114855-55114877 CTGGGGCCTCTGGGGGATGCAGG + Intronic
1168340759 19:55621836-55621858 CTGGGCTCGTCGGCGGCTGAGGG - Exonic
1168641318 19:58033806-58033828 GTGGAGACGGTGGCGGCTGCGGG - Intergenic
926008100 2:9388489-9388511 CTGGTGGTGCTGGGGGCTGCAGG - Exonic
929787177 2:45001343-45001365 CTGGAGCCGCTGCCGGCGGCCGG - Intergenic
929936545 2:46297850-46297872 CTGGGCTCCCTGGCGGGTGGGGG - Exonic
930019850 2:46994939-46994961 CTGCGGTGGGTGGTGGCTGCTGG - Intronic
930236100 2:48890167-48890189 CTTGGGAGGCTGGCAGCTGCAGG + Intergenic
932419392 2:71592535-71592557 CTGGGGCGGCTGGCGGCCGGAGG + Intronic
932436773 2:71706374-71706396 CTGAGGGCGGTGGGGGCTGCAGG + Intergenic
932735844 2:74254054-74254076 CTGGCGGTGCTTGCGGCTGCAGG - Intronic
933603228 2:84354486-84354508 CTGGGGGAAGTGGCGGCTGCGGG + Intergenic
934504436 2:94879814-94879836 GAGGGGTTGCTGGGGGCTGCTGG + Intergenic
934656050 2:96117172-96117194 CTGGGCCCGCGGGCGGCAGCAGG - Intergenic
935820322 2:106887021-106887043 CTCGGGTCCCGGGCGGCGGCAGG + Intronic
936350499 2:111708748-111708770 CTGAGGTTGCTGGCAGTTGCTGG + Intergenic
936937491 2:117852208-117852230 GTGGGGTCGGTGGTGGCTACTGG + Intergenic
938328117 2:130427912-130427934 GTGGGGTCGCCGGGGGCTTCGGG - Intergenic
938562774 2:132489356-132489378 TGGGGGCCGCTGGCGGCTCCTGG + Intronic
944955131 2:204799248-204799270 CCTGGGTCGCTGGTGGCTGCAGG + Intronic
948432669 2:237929957-237929979 CTGGGGTGGCTTGGGGGTGCTGG - Intergenic
948742017 2:240054366-240054388 CTGGAATCCCTGGCTGCTGCAGG + Intergenic
948793874 2:240392363-240392385 CTGGGGTCATTGGCAGCAGCTGG + Intergenic
948843705 2:240672867-240672889 CTGGGCGCGCTGGGGGCCGCTGG + Intergenic
1168847385 20:954774-954796 CTGGCGTCACTGGCGGCGACGGG + Intergenic
1172061578 20:32190301-32190323 CGGGGCGCGCTGGCGACTGCGGG + Intergenic
1172099686 20:32477739-32477761 GTGGGGTGGCTGGCAGCGGCAGG - Intronic
1174380637 20:50153452-50153474 CTGGGGTCGCTGTCCGCAGCCGG + Intronic
1175877027 20:62235225-62235247 CTGGCCTGGCTGGCAGCTGCTGG - Intronic
1175946491 20:62561355-62561377 CTGGGGACGGCTGCGGCTGCAGG + Intronic
1175957484 20:62618780-62618802 CTGGGGTTGCTGGCTGCTCCTGG - Intergenic
1176082574 20:63281389-63281411 CTCGGGACACTGGCTGCTGCTGG + Intronic
1176159104 20:63639656-63639678 GTGGGGTCGGGGGCAGCTGCGGG - Intergenic
1176258706 20:64167498-64167520 GTGGGGTGGGTGGGGGCTGCTGG + Intronic
1176621617 21:9065384-9065406 GAGGGGTTGCTGGGGGCTGCTGG - Intergenic
1178303380 21:31470914-31470936 CGGGGGTGGGTGGCGGCTGGAGG - Intronic
1178832804 21:36070448-36070470 CTGGGGCTCCTGGCGTCTGCGGG + Intronic
1178942276 21:36915884-36915906 CTGGGGTCTCTGGGGGCTCTCGG + Intronic
1179430225 21:41316625-41316647 CTGAGGTCGCTGGCGGAGGGTGG - Intronic
1179884859 21:44309550-44309572 GTGGGGTCTCTGGGGACTGCTGG + Intronic
1180001204 21:44996295-44996317 GTGGGCAGGCTGGCGGCTGCTGG + Intergenic
1180052480 21:45337706-45337728 CAGGGGACACTGGGGGCTGCTGG + Intergenic
1180167778 21:46038938-46038960 CTGGGGCCTCTGGCGGCTGCTGG + Intergenic
1180606247 22:17061197-17061219 CTGGGATCTCTGGCTGATGCTGG - Intergenic
1180983203 22:19889075-19889097 TAGGGGTCCCTGGTGGCTGCTGG - Intronic
1181697895 22:24603021-24603043 CTGGGACCGCTGCAGGCTGCAGG - Intronic
1181813772 22:25421376-25421398 AGGGGGTCGCTGGCGGCCGCAGG - Intergenic
1181831731 22:25565196-25565218 AGGGGGTAGCTGGCGGCCGCAGG - Intronic
1183582135 22:38732312-38732334 CTGGGGCCCCTGGCGACAGCTGG + Exonic
1183647379 22:39134458-39134480 CTGGGGCCGGTGGCTCCTGCAGG + Exonic
1184465843 22:44668636-44668658 CTGGGGGCTGCGGCGGCTGCGGG + Intronic
952115873 3:30180869-30180891 CTTGGTTAGCTGGCAGCTGCAGG + Intergenic
952744451 3:36764221-36764243 CCGGGGGCGGCGGCGGCTGCGGG + Intergenic
956659391 3:71583320-71583342 CTGGGATGGGTGGGGGCTGCGGG - Intronic
956912665 3:73835129-73835151 GTGGGGTTGCTGGCAGCAGCAGG - Intergenic
961088134 3:124087678-124087700 CTGGGATAGCTGGCAGCTCCAGG + Intronic
961210347 3:125120605-125120627 CTGGGCTCCCTGGCAGCTGTTGG - Exonic
961603364 3:128076898-128076920 ATGGGGACGCCGGCAGCTGCGGG - Intronic
961747174 3:129071608-129071630 CTGGGGTCTCAGGCAGGTGCAGG + Intergenic
961827615 3:129606955-129606977 CTGGGGCCGCGGGCGGGTCCTGG - Intergenic
963335853 3:143972560-143972582 GTGGGGCCGCTTGCGCCTGCTGG + Exonic
966907784 3:184540220-184540242 GTGGGGGCGCTGGAGCCTGCTGG - Intronic
968479357 4:826564-826586 CGGGGGTCGCAGGCGCCCGCCGG - Intergenic
968583063 4:1403800-1403822 AAGGGGTCGCCGGCGTCTGCGGG + Exonic
968605371 4:1532720-1532742 TGGGGGTCCCTGGAGGCTGCTGG - Intergenic
969609323 4:8218170-8218192 CTCAGGTTGCTGGGGGCTGCTGG + Intronic
969615727 4:8251659-8251681 GTGGGGAAGCTGGAGGCTGCAGG - Intergenic
971231027 4:24800258-24800280 CGGGGGTCCCTGGCCGCCGCCGG - Exonic
972544831 4:40070572-40070594 CTGGAGTGGCTGGGGGCTACAGG + Intronic
973718718 4:53702544-53702566 CTGGGGTCTCCTGAGGCTGCAGG + Intronic
973824517 4:54691744-54691766 GTGGGGTGGGTGGCGGCTGGCGG + Intronic
977087988 4:92628947-92628969 GTGGGGTGGCAGGTGGCTGCTGG + Intronic
978384729 4:108168045-108168067 CTGCGGTAGCTGGCGACTCCGGG + Exonic
979624029 4:122826760-122826782 CTGGGGGCGCGGGAGGCTGGTGG + Exonic
981504225 4:145482168-145482190 CTGGGGGCGCGGGCAGCGGCGGG + Intronic
985492174 5:186515-186537 CTGGGGGCGCTGGGAGCTGAGGG + Exonic
985493374 5:191841-191863 CCGGAGCCGCCGGCGGCTGCGGG + Exonic
985504661 5:271970-271992 CAGGGGTCGGGGGCGGCGGCAGG - Intronic
986338214 5:6770187-6770209 AAGGGGAGGCTGGCGGCTGCAGG + Intergenic
987373986 5:17217737-17217759 CCGGGGTCGCTGGCGTCGTCTGG - Exonic
995354705 5:111224395-111224417 CTGCGTTCGCAGGCGGCGGCTGG + Exonic
996765154 5:127028965-127028987 ATGGGCCGGCTGGCGGCTGCTGG + Intronic
997682007 5:135763433-135763455 CTGGGCTGGCTGGAGGGTGCTGG - Intergenic
998182706 5:139956498-139956520 CTGGGGACCCTGGAGGATGCTGG - Intronic
1000245714 5:159446995-159447017 CTGGGGTCCCTGCCCCCTGCAGG - Intergenic
1001381903 5:171311028-171311050 CCGGGGTCGCTGGGGTCCGCGGG - Intronic
1003652295 6:7972400-7972422 CTAGGGTTGCAGGTGGCTGCTGG - Intronic
1005379518 6:25218640-25218662 GTGGGGTCCCTGCGGGCTGCAGG - Intergenic
1006094095 6:31645008-31645030 CTCGGGTGGCTGGTGGCTGGCGG + Exonic
1006517235 6:34551821-34551843 CTGGGGTCCCTGCTGGCTGGAGG - Intronic
1006839237 6:37017770-37017792 CTGGGGTCTCTGGAGGCCCCAGG - Intronic
1006910372 6:37559521-37559543 CTGTGGTCGGAGGAGGCTGCAGG - Intergenic
1008932480 6:56954972-56954994 CTGAGGTCGGCGGCGGCCGCAGG - Intergenic
1009338651 6:62526312-62526334 CTGGGGTGGCAGGTTGCTGCTGG + Intergenic
1017457562 6:154615748-154615770 CTGTGGTGAGTGGCGGCTGCTGG + Intergenic
1019314645 7:378930-378952 CTGGGGGTCCTGGCGCCTGCGGG - Intergenic
1019917927 7:4145199-4145221 CTGGGGTCCCTGGAGGGAGCTGG + Intronic
1021006182 7:15397315-15397337 CTCGGGTTCCGGGCGGCTGCGGG - Intronic
1022094561 7:27130586-27130608 TCGGGGGCGCTGGGGGCTGCTGG + Exonic
1022943745 7:35262100-35262122 ACGGTGTCGCTGGCGGCGGCGGG + Intergenic
1024004637 7:45216510-45216532 CTGGAGAAGCTGGCGGCTCCTGG + Intergenic
1024561850 7:50651336-50651358 CTGGAGGTTCTGGCGGCTGCTGG + Intronic
1026941303 7:74289486-74289508 CGGGGCGCGCAGGCGGCTGCTGG + Exonic
1027131072 7:75591853-75591875 CTGGGGTCTCTGGACGCTTCAGG - Intronic
1029147768 7:98458805-98458827 CTGTGGTGGCTGGCGGCTCTGGG + Intergenic
1029707431 7:102283208-102283230 CTGGGGCCTCTGGCAGCTGCTGG - Intronic
1030788612 7:113695038-113695060 CTGGGGTCCCTGGCAGCAGGTGG + Intergenic
1031899252 7:127392129-127392151 CTGGCGTGGGAGGCGGCTGCGGG + Intronic
1032119317 7:129144955-129144977 CCGGGGGCGGTGGCGGCGGCGGG + Exonic
1032515626 7:132504168-132504190 CTGAGCTCTCTGGGGGCTGCAGG + Intronic
1034829815 7:154299261-154299283 CTGAGGTCCCTGGAAGCTGCTGG - Intronic
1035354048 7:158266389-158266411 CTGGGGACGGTGTCTGCTGCGGG + Intronic
1036095547 8:5721253-5721275 CTGGGATTGCTGGCGGCTACTGG - Intergenic
1036556132 8:9862111-9862133 CTGGGGGTGCTGGCAGCTGGAGG - Intergenic
1037799582 8:22025103-22025125 GAGGGGTCGCTCGCGGCTGGAGG - Exonic
1038828451 8:31032870-31032892 TGGGGGTCGCGGGCGGCGGCGGG - Exonic
1044629355 8:94263525-94263547 CTGGGTTGGCTGGTGGCTCCGGG + Intergenic
1045751154 8:105485402-105485424 CTGGGTTCTCTGGAGGCTGAGGG + Intronic
1049182203 8:141228773-141228795 CTGGGGTAGCTGTTGGCTTCTGG - Intronic
1049223114 8:141436863-141436885 CTGGGGGTGGTGGCGGCTGGTGG + Intergenic
1049422941 8:142524890-142524912 CTGGGGTCACTGGCCTCTACTGG + Intronic
1049762935 8:144339026-144339048 CAGGGGTCCCGGGGGGCTGCGGG - Intergenic
1051265540 9:15306196-15306218 CTGTGGGTGCTGGCTGCTGCTGG + Intronic
1052857685 9:33417286-33417308 TTGGGGGCGCTGGAGGCTGGTGG - Intergenic
1054825051 9:69565399-69565421 ATGGGCTCGCTGGAGACTGCTGG - Intronic
1057054252 9:91949319-91949341 GTGGGGGCGCCGGCGGCTCCCGG - Intronic
1057155746 9:92837448-92837470 CTGGGGCCGCTGGAGGCCCCGGG + Intergenic
1057619171 9:96619634-96619656 CTGGGGGCGCCGGCCGCGGCAGG - Exonic
1059210802 9:112513473-112513495 CTGGGGTCGGTGGCCGCGGCTGG + Intronic
1060770068 9:126326511-126326533 CTGGGGTCGCCGGCGGGCTCGGG + Intergenic
1061090427 9:128422911-128422933 CAGGAGTGGCTGGCGGCTGTGGG + Exonic
1061284523 9:129614480-129614502 TTGGGGACCCTGGGGGCTGCTGG + Intronic
1061856078 9:133442690-133442712 CTGGCCACGCTGGTGGCTGCTGG - Exonic
1062218805 9:135403455-135403477 CTGGGGTCCCTGGCCGTGGCAGG - Intergenic
1062566846 9:137167352-137167374 CTGGGGTCCCTGGCGGCCGGCGG + Intronic
1062569498 9:137178617-137178639 CTGGTGTCTCTGGAGCCTGCGGG - Intronic
1062597578 9:137306121-137306143 CTGGGGTTGCTGGGGGCTGAAGG + Intergenic
1185641517 X:1591652-1591674 CGGGGGACGGTGGCGGCTCCCGG + Exonic
1185762090 X:2696340-2696362 CTGGTGTAGCTGCAGGCTGCAGG + Intronic
1187380307 X:18795501-18795523 CTGGAGTCTCTGGCAGCTTCTGG + Intronic
1197900431 X:131365988-131366010 CTGAACTCGCTGGGGGCTGCTGG - Intronic
1198585271 X:138113881-138113903 CTGGGGTCTCTAAAGGCTGCTGG - Intergenic
1201148628 Y:11082075-11082097 CTGGGGACACTGGGGCCTGCTGG - Intergenic