ID: 1132547863

View in Genome Browser
Species Human (GRCh38)
Location 16:541437-541459
Sequence CGGCAAAGGCAGGGCCGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 496
Summary {0: 1, 1: 1, 2: 4, 3: 31, 4: 459}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132547854_1132547863 -3 Left 1132547854 16:541417-541439 CCCTGATGGACAGAGAGACGCGG 0: 1
1: 0
2: 1
3: 11
4: 100
Right 1132547863 16:541437-541459 CGGCAAAGGCAGGGCCGGGGAGG 0: 1
1: 1
2: 4
3: 31
4: 459
1132547850_1132547863 20 Left 1132547850 16:541394-541416 CCTGGAGCCCTGTCTGCGAGTTA 0: 2
1: 0
2: 0
3: 4
4: 92
Right 1132547863 16:541437-541459 CGGCAAAGGCAGGGCCGGGGAGG 0: 1
1: 1
2: 4
3: 31
4: 459
1132547852_1132547863 12 Left 1132547852 16:541402-541424 CCTGTCTGCGAGTTACCCTGATG 0: 1
1: 1
2: 0
3: 2
4: 36
Right 1132547863 16:541437-541459 CGGCAAAGGCAGGGCCGGGGAGG 0: 1
1: 1
2: 4
3: 31
4: 459
1132547849_1132547863 21 Left 1132547849 16:541393-541415 CCCTGGAGCCCTGTCTGCGAGTT 0: 2
1: 0
2: 0
3: 11
4: 105
Right 1132547863 16:541437-541459 CGGCAAAGGCAGGGCCGGGGAGG 0: 1
1: 1
2: 4
3: 31
4: 459
1132547851_1132547863 13 Left 1132547851 16:541401-541423 CCCTGTCTGCGAGTTACCCTGAT 0: 1
1: 1
2: 0
3: 2
4: 55
Right 1132547863 16:541437-541459 CGGCAAAGGCAGGGCCGGGGAGG 0: 1
1: 1
2: 4
3: 31
4: 459
1132547856_1132547863 -4 Left 1132547856 16:541418-541440 CCTGATGGACAGAGAGACGCGGC 0: 1
1: 0
2: 1
3: 1
4: 78
Right 1132547863 16:541437-541459 CGGCAAAGGCAGGGCCGGGGAGG 0: 1
1: 1
2: 4
3: 31
4: 459

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132547863 Original CRISPR CGGCAAAGGCAGGGCCGGGG AGG Intronic
900213468 1:1468572-1468594 CCGCAAAGGCAGGGGTGGGAGGG - Exonic
900221030 1:1509393-1509415 CCGCAAAGGCAGGGGTGGGAGGG - Intergenic
900719695 1:4167309-4167331 CCTCAAGGGCAGAGCCGGGGTGG - Intergenic
900853362 1:5161611-5161633 CTGCAAGGGCAGGGCAGGGAAGG - Intergenic
901325884 1:8364887-8364909 CAGCCAAGGCTGGGCCGGTGGGG + Intronic
901886966 1:12230160-12230182 CGGGAACTGCAGGGCCGGCGCGG + Intronic
902479480 1:16704213-16704235 CGGCAAAGGCATGGCTGAGTAGG - Intergenic
903071030 1:20727109-20727131 AGGCCAAGGCAGGGTCTGGGAGG - Intronic
903446151 1:23424164-23424186 CGGCGATGGCGGGGGCGGGGCGG - Intronic
903467150 1:23559570-23559592 CGGCGGGGGCAGGGCCGAGGCGG - Exonic
903613700 1:24636323-24636345 GGGCAAAGGAAGGGCTGGGAAGG + Intronic
903878212 1:26490800-26490822 GCACAAAGGCAGGCCCGGGGTGG - Intergenic
903959301 1:27046704-27046726 ACCCAAAGGCAGGGCAGGGGTGG - Intergenic
904339471 1:29824766-29824788 GGCCAGAGGCAGGGCAGGGGAGG + Intergenic
904467819 1:30718593-30718615 GGGCAGGGGCGGGGCCGGGGGGG - Intronic
905171871 1:36114491-36114513 AGGAAAAGGCAGGGACAGGGAGG - Intronic
905370488 1:37480180-37480202 CACCAAAGCCAGGGCAGGGGTGG + Intronic
905490804 1:38342354-38342376 AGGCAAAGGCAGGGGAGAGGAGG + Intergenic
905790293 1:40785825-40785847 CGGCACAGGGAGGGGCAGGGGGG + Intronic
906290769 1:44617948-44617970 AGGCAAAGGCAGGGTAGGAGAGG - Intronic
907043914 1:51288056-51288078 CCCCAAAGGCAGGGCAGGGCAGG + Exonic
907124317 1:52035753-52035775 AGGAAAAGGCAGGGCAGGGGAGG - Intronic
907501739 1:54886454-54886476 CGACAAGTGCAGGGCAGGGGCGG - Intronic
910237212 1:85048317-85048339 GCGCACAGGGAGGGCCGGGGAGG - Intronic
911176482 1:94822726-94822748 AGGAAAAGGCAGGGCAGGAGAGG - Intronic
912879020 1:113390660-113390682 CGGGAAAGGCTGAGGCGGGGGGG - Intergenic
913318999 1:117575751-117575773 CGGTCAAGGCAGGGTGGGGGTGG + Intergenic
915075543 1:153305821-153305843 CAGCAAAGCCAGGGAAGGGGTGG - Intronic
915313772 1:155017181-155017203 CGGCAAAGGAAGGGTAGGTGGGG + Exonic
915318017 1:155040634-155040656 CTGCACAGGCAGAGCCTGGGGGG + Intronic
915973217 1:160368167-160368189 CAGGAAAGCCAGGGCTGGGGAGG + Intronic
919981103 1:202643384-202643406 CCGCAGCGGCAGGGCCGGCGGGG - Exonic
922503038 1:226110573-226110595 TGGGGAAGGCAGGGCCGGCGCGG + Intergenic
922806604 1:228393547-228393569 AGGCAAAGTAAGGGCCGGGACGG - Intergenic
923533208 1:234827949-234827971 GAGCAAAGGCAGGGCTGGGCTGG - Intergenic
923778162 1:236998229-236998251 GGCCAAAGGCAGGGCCCAGGCGG + Intergenic
1062897818 10:1117791-1117813 CTGCAGAGCCAGGGCCCGGGTGG + Intronic
1062932004 10:1359716-1359738 CTGGAATGGCAGGGCCGCGGCGG - Intronic
1063029957 10:2224931-2224953 AGGCAAAGGCAAGGCTGGGTGGG - Intergenic
1063949864 10:11212337-11212359 CTGTGAAGGCAGGCCCGGGGGGG - Intronic
1064354215 10:14603778-14603800 AGACAAAGCCGGGGCCGGGGAGG - Intronic
1065416426 10:25492260-25492282 TGGCAGAGGCAGGGCCTGGTGGG - Intronic
1066221296 10:33337207-33337229 CGGGAAAGACAAGGTCGGGGTGG - Intergenic
1066444011 10:35465278-35465300 GCACAAAGGCAGGGGCGGGGCGG - Intronic
1066961772 10:42232499-42232521 CGGCAGGGCCAGGGCCAGGGAGG + Intergenic
1066962184 10:42233952-42233974 AGGCCAAGGTAGGGCCAGGGCGG + Intergenic
1067057463 10:43060649-43060671 GGGCAAGGGCAGGGGCCGGGAGG + Intergenic
1067438786 10:46296696-46296718 AGGAAAAGGCAGGGCTGGAGAGG + Intronic
1067582228 10:47452910-47452932 GGGCAGAGGGAGGGCAGGGGAGG + Intergenic
1068915445 10:62426665-62426687 CGGGAAAGGCAAGGCTGGGCAGG + Intronic
1069470731 10:68687137-68687159 AGGCCAAGGCGGGGGCGGGGGGG - Intronic
1070162430 10:73874268-73874290 CGGGAAAGGCGGGGGTGGGGCGG + Intronic
1070665790 10:78342468-78342490 GGGCAGAGACAGGGCTGGGGAGG + Intergenic
1072210415 10:93241149-93241171 TGGTAAGGGCAGGGCTGGGGAGG + Intergenic
1072591496 10:96832271-96832293 CGGCGGAGGCTGGGCCGGGCGGG + Intronic
1072686748 10:97542187-97542209 CGCCAGATGCAGGGCCTGGGTGG - Intronic
1073063439 10:100745372-100745394 CGGCTAGGGGAGGGCAGGGGAGG - Intronic
1074088361 10:110225922-110225944 GGGCAGAGGCAGGGGCGGGAGGG + Intronic
1074292199 10:112146485-112146507 AGGGAAAGGCAGGGCAGGGCAGG - Intergenic
1075782566 10:125026675-125026697 CTGCGGAGGCAGGACCGGGGGGG - Exonic
1076305867 10:129465683-129465705 CATCCAAGGCAGGGTCGGGGTGG + Intergenic
1076513082 10:131025905-131025927 GGGCAACGTCAGGGCCTGGGTGG - Intergenic
1076711667 10:132339104-132339126 TGGCCACGGCAGGGCCTGGGTGG + Intronic
1076792488 10:132784723-132784745 GGGCGAAGCCGGGGCCGGGGAGG + Intergenic
1076793350 10:132787758-132787780 CGGGAACTGCGGGGCCGGGGGGG + Intergenic
1076861521 10:133140273-133140295 GGGCAGGGGCAGGGCAGGGGCGG - Intergenic
1076861553 10:133140361-133140383 GGGCAGGGGCAGGGCAGGGGCGG - Intergenic
1077034620 11:488662-488684 CTGCGAGGGCAGGGCCGGGTGGG + Intronic
1077073193 11:687150-687172 CTGCAAAGGCAGACCCGTGGTGG - Intronic
1077083657 11:736496-736518 AGGGGAAAGCAGGGCCGGGGTGG + Intergenic
1077173486 11:1178647-1178669 CGGCGAAGGTGGGGCCGTGGAGG - Intronic
1077186368 11:1237128-1237150 CGGCGAAGGTGGGGCCGTGGAGG - Exonic
1077229519 11:1452395-1452417 CGGCAATGTCAGGGCCTAGGCGG - Intronic
1077229822 11:1453752-1453774 AGGCAGAGGCAGGGACCGGGAGG - Intronic
1077341209 11:2027177-2027199 AGAGACAGGCAGGGCCGGGGTGG + Intergenic
1079427625 11:20358563-20358585 GGGCAGGGGCAGGGCAGGGGAGG - Intergenic
1080037271 11:27722548-27722570 GGGCCAAGGCAGGGACGGGAGGG + Intergenic
1081650110 11:44818252-44818274 CTGCATGGGCAGGGCCGTGGAGG - Intronic
1083944997 11:65918868-65918890 GGGGCAGGGCAGGGCCGGGGCGG - Intronic
1083952604 11:65965240-65965262 AGGCAAGGGAAGGGCTGGGGAGG + Intronic
1083955207 11:65979041-65979063 AGGTTGAGGCAGGGCCGGGGCGG - Exonic
1084177968 11:67433279-67433301 GGGCAAGGGCAGGGCCTGGTGGG + Intronic
1084372279 11:68751608-68751630 AGGTAAAGGCGGGGCCAGGGAGG + Intergenic
1084524268 11:69686096-69686118 CGGCGAAGAGAGGGCCCGGGAGG - Intergenic
1084946704 11:72642506-72642528 GGACATAGGCGGGGCCGGGGCGG - Intronic
1085690025 11:78657073-78657095 TGGCAAAGGCATGGCAGTGGTGG - Exonic
1088739020 11:112751598-112751620 CTGCAAGGGCATGGCTGGGGAGG + Intergenic
1089069586 11:115689158-115689180 CAGCGAGGGAAGGGCCGGGGAGG - Intergenic
1089195838 11:116693569-116693591 GGGCCAAAGCAGGGCCAGGGTGG + Intergenic
1089616384 11:119697041-119697063 GGGCAGAGGCCGGGCCTGGGAGG + Intronic
1089770224 11:120797196-120797218 CAGCAAAGGCAGGGCTGAGATGG - Intronic
1090178605 11:124673755-124673777 CGGCAGGGGCGGGGCCTGGGCGG + Exonic
1091026193 11:132143286-132143308 AGGCCCAGGCAGGGCCTGGGAGG - Intronic
1202824194 11_KI270721v1_random:82366-82388 AGAGACAGGCAGGGCCGGGGTGG + Intergenic
1092126319 12:6077448-6077470 TGGGCAAGGCAGGGCCGTGGAGG - Intronic
1096080445 12:48829042-48829064 GGACAAAGGCAGAGCTGGGGAGG + Intergenic
1096238043 12:49943100-49943122 TGGCAAAGGAAGGGCAGGGCAGG + Intergenic
1096396395 12:51269861-51269883 CGGCGAAAGCAGGCCCGGAGGGG - Intronic
1096465558 12:51846460-51846482 CGGCCCAGGCAGGGCAGGGAGGG + Intergenic
1097090574 12:56501287-56501309 CGGGAAAGGGCGGGGCGGGGGGG - Intergenic
1097234325 12:57529175-57529197 CGGCCAGGGCGGGCCCGGGGAGG - Exonic
1100888515 12:99099139-99099161 CGGCAGAGGGAGGGCTTGGGTGG + Intronic
1102018320 12:109663470-109663492 TGGCAAGGTCAGGGCGGGGGGGG - Intergenic
1102937707 12:116911373-116911395 CGGCGCAGGCATGGGCGGGGGGG - Intronic
1103719071 12:122963912-122963934 CAGCACAGGCAGGGCTGGGGAGG - Intronic
1103799269 12:123526756-123526778 GGTGAAGGGCAGGGCCGGGGTGG + Intronic
1103994000 12:124817495-124817517 CGGCTGAGGCTGGGCAGGGGAGG - Intronic
1104376303 12:128267480-128267502 GGGCAAAGGTAAGGCCGGGGCGG + Exonic
1105957931 13:25301618-25301640 CGGCGAAGGCAAGGCTGAGGGGG - Exonic
1112570447 13:100588761-100588783 CGGGGAGGGCAGGGCCAGGGCGG + Intronic
1112580863 13:100675109-100675131 AGGCGGAGGCGGGGCCGGGGCGG + Intergenic
1112752586 13:102597303-102597325 CGGCCGAGTCCGGGCCGGGGTGG + Intronic
1113614562 13:111671282-111671304 CAGCAGAGGCAGGGCAGTGGCGG + Intronic
1113620030 13:111756196-111756218 CAGCAGAGGCAGGGCAGTGGCGG + Intergenic
1113656796 13:112072720-112072742 CTGGAGAGGAAGGGCCGGGGAGG - Intergenic
1113777064 13:112953839-112953861 CGGCAAAGGCAGGGAAGACGAGG + Intronic
1113844536 13:113378983-113379005 GGGCACAGGCAGGGCCTGGCTGG + Intergenic
1113844557 13:113379097-113379119 GGGCACAGGCAGGGCCTGGCTGG + Intergenic
1113913870 13:113859788-113859810 CTGTCAAGGCAGGGCAGGGGAGG + Intronic
1114269064 14:21090548-21090570 CCGGAGAGGCAGGGCTGGGGGGG - Exonic
1114627425 14:24138567-24138589 AGGCAAGGGCAGGGCAGGGGTGG + Exonic
1116157688 14:41228714-41228736 AGGCCAAGGCGGGGCGGGGGGGG - Intergenic
1118265811 14:64294221-64294243 CGGCGAGCGCTGGGCCGGGGAGG - Exonic
1118992353 14:70808740-70808762 AGGCGAAGGCGGGGCCGGGCGGG - Intronic
1119028635 14:71174281-71174303 CGGCAAGGGCAGAGCCAGGCTGG - Intergenic
1119519701 14:75277105-75277127 CGGCCGCGGCCGGGCCGGGGAGG + Intergenic
1119765036 14:77182565-77182587 CGGTGAAGGCAGTGCCTGGGAGG - Intronic
1121956527 14:98218431-98218453 CAGCAAAGCCAGGGCGTGGGAGG + Intergenic
1122155364 14:99747342-99747364 GGAGAAAGGCAGGCCCGGGGTGG + Intronic
1122250682 14:100437267-100437289 GGGCTAAGGCTGGGCCGTGGGGG - Intronic
1122277950 14:100604898-100604920 TGGCAAGGACAGGGACGGGGAGG - Intergenic
1122447672 14:101781497-101781519 TGGCAAGGGCAGGGGCGGGGAGG - Intronic
1122690161 14:103528473-103528495 CGGGGGAGGCAGGGCCTGGGCGG + Intergenic
1122899170 14:104775061-104775083 TGGCCAAGGTGGGGCCGGGGCGG - Exonic
1122945710 14:105007953-105007975 CGGAAAGGGCCGGGCTGGGGTGG - Intronic
1123412916 15:20074074-20074096 AGGCTGAGGCTGGGCCGGGGTGG + Intergenic
1123522258 15:21081187-21081209 AGGCTGAGGCTGGGCCGGGGTGG + Intergenic
1124496796 15:30192114-30192136 CCGCAGCGGCAGGGCCGGCGGGG - Intergenic
1124746780 15:32346533-32346555 CCGCAGCGGCAGGGCCGGCGGGG + Intergenic
1125859729 15:42987187-42987209 CGGCAGGGGCAGAGCCGGGATGG + Intronic
1127803948 15:62501353-62501375 GGCCAAGGGCAGGGCTGGGGTGG + Intronic
1129698871 15:77756064-77756086 AGGCTAAGGCAGGGCTGGAGAGG + Intronic
1129882314 15:79015542-79015564 TGGCAAAGGCAGGGTCAGCGTGG + Intronic
1130630075 15:85558944-85558966 CGGCAAAGGGAGGGAGGAGGAGG - Intronic
1131011487 15:89021773-89021795 AGGGAATGGCAGGGCCAGGGTGG - Intergenic
1131162141 15:90113279-90113301 CTGCAAAAGGAAGGCCGGGGCGG - Intergenic
1131166386 15:90145048-90145070 TGGCAAGGGCAGAGCCTGGGAGG - Intergenic
1131861068 15:96653659-96653681 CGGGAAAGGCAAGGCCAGGCAGG + Intergenic
1132547839 16:541355-541377 CGGCAGAGGCAGGGCCGGGGAGG + Intronic
1132547863 16:541437-541459 CGGCAAAGGCAGGGCCGGGGAGG + Intronic
1132608167 16:802099-802121 GGGCACAGGCAGGGCAGGGCGGG - Intergenic
1132614171 16:832085-832107 AGGCCAGGGCAGGGCCGGGGCGG + Intergenic
1132825782 16:1904581-1904603 GGGGAAAGGCAGGGCAGGGCGGG - Intergenic
1132847173 16:2005963-2005985 GGGCAGAGGCAGGGCCAGGCCGG + Intronic
1132864775 16:2087934-2087956 CAGGAAAGGTAGGGCCGGGTGGG + Exonic
1132864787 16:2087968-2087990 CAGGAAAGGTAGGGCCGGGTGGG + Intronic
1133005959 16:2882227-2882249 CTGCAGAGCCAGGGCCGGGAGGG + Intergenic
1133010047 16:2905678-2905700 GGGCTAGGGCTGGGCCGGGGCGG + Intergenic
1133038573 16:3047564-3047586 GTGCAGAGGCAGGGCTGGGGAGG - Intronic
1133270950 16:4610591-4610613 GGGCAGCGGCAGGGCCGGCGGGG - Intronic
1133286812 16:4694402-4694424 CGGGAAAGGAGGGGCGGGGGTGG + Intronic
1133305044 16:4803125-4803147 AGGCAGCGGCGGGGCCGGGGTGG - Intergenic
1133333071 16:4988126-4988148 CTGCAAGGGAAGGGGCGGGGAGG - Intronic
1133995372 16:10744111-10744133 CGGAAAAGGCGGGGCGTGGGAGG + Intronic
1134373475 16:13647842-13647864 ATGCAAAGGCAGGGTCGGGGAGG - Intergenic
1135047707 16:19168456-19168478 AGGGAAAGGCAAGGACGGGGCGG + Exonic
1136265754 16:29117092-29117114 CGGCAGTGGGGGGGCCGGGGAGG + Intergenic
1136723025 16:32339271-32339293 GGGCACAGGCAGGGCGGGGCCGG + Intergenic
1136841345 16:33545270-33545292 GGGCACAGGCAGGGCGGGGCCGG + Intergenic
1137562322 16:49510816-49510838 CGGCTGAGGCAGCGCCGGGGAGG + Intronic
1138105228 16:54284413-54284435 CGGGAGGGGCAGGGCCCGGGGGG - Intronic
1139338638 16:66251777-66251799 CAGCAAAGGCAGGGACAGGGAGG + Intergenic
1139483594 16:67244362-67244384 TGGCAAAGGCAGGTCTGGGCTGG + Intronic
1140476761 16:75242842-75242864 AGGCTGAGGCTGGGCCGGGGTGG + Exonic
1141180964 16:81753150-81753172 GGGGAGAGGCAGGGCCGAGGGGG - Intronic
1141619120 16:85227512-85227534 CAGCACAGGCAGGGCCCAGGAGG + Intergenic
1141694789 16:85614178-85614200 CGGAGCAGGAAGGGCCGGGGAGG - Intronic
1141772730 16:86101004-86101026 AGCCACAGGCAGGCCCGGGGAGG + Intergenic
1141972424 16:87492691-87492713 CGGCGACGGCATGGCCGGGGCGG - Intergenic
1142049200 16:87946972-87946994 TGGCAAAGTCAGGGGAGGGGTGG + Intergenic
1142147915 16:88500148-88500170 GGGCAACGGCGGGGCCTGGGTGG - Intronic
1142173417 16:88634404-88634426 AGACAAACGCAGGGCCGGGCGGG - Intergenic
1203003406 16_KI270728v1_random:178493-178515 GGGCACAGGCAGGGCGGGGCCGG - Intergenic
1203124456 16_KI270728v1_random:1561884-1561906 GGGCACAGGCAGGGCGGGGCTGG - Intergenic
1203135014 16_KI270728v1_random:1714900-1714922 GGGCACAGGCAGGGCGGGGCCGG - Intergenic
1203151510 16_KI270728v1_random:1845567-1845589 GGGCACAGGCAGGGCGGGGCCGG + Intergenic
1142836501 17:2591800-2591822 AGGCCAAGGCAGGGATGGGGAGG - Intergenic
1143515597 17:7417820-7417842 CGGGCCAGGGAGGGCCGGGGAGG - Exonic
1143935088 17:10475599-10475621 AGGCAAAGGGAGGGGAGGGGAGG - Intergenic
1144451290 17:15381552-15381574 CAAGAAAGGCAGGGCAGGGGAGG - Intergenic
1144822952 17:18088232-18088254 CGCCCAAGGCAGGGCCAGGCGGG + Intronic
1145056786 17:19708199-19708221 CGGCACAGGCAGGGCCAGGATGG + Intronic
1145265909 17:21379520-21379542 CTCCAAGGGCAGGCCCGGGGAGG - Intronic
1145318025 17:21746453-21746475 CGGCAAAGCCAGGGCAGAGCAGG + Intergenic
1145327246 17:21842581-21842603 CGGCAAAAGCCGTGGCGGGGGGG - Intergenic
1146057966 17:29590432-29590454 AGGCAAAGGCAAGGCAGGTGAGG + Intronic
1146275048 17:31511257-31511279 CGGCAAAAGGAGGCGCGGGGTGG - Intronic
1146283337 17:31559152-31559174 GGGCGAAGGGCGGGCCGGGGCGG + Intergenic
1146486841 17:33249780-33249802 CACCAAAGGCAGGGCGGGTGGGG + Intronic
1147149970 17:38509031-38509053 AGGGGAAGGCAGGGGCGGGGCGG + Intronic
1147896660 17:43755835-43755857 TGGCAAAAGCAGGGCTGGGGTGG - Intronic
1148048833 17:44759445-44759467 CGGCAGGGGCAGGGACGCGGTGG - Intronic
1148467298 17:47872736-47872758 CGGCAAGGGCAGGGCCCCGAGGG + Intergenic
1148565244 17:48628735-48628757 CTGCAAAGTCAGGGCAGGAGAGG - Intronic
1148851535 17:50557881-50557903 GGGTAAAGGCAGGGCTGGAGGGG + Intergenic
1149146860 17:53504849-53504871 TGGCAAAGGCAAGGCAGGGCAGG - Intergenic
1151819844 17:76491470-76491492 CAGCAGAGACAGGGCCAGGGCGG + Intronic
1151894229 17:76969362-76969384 AGGAGAAGGCAGGGCTGGGGCGG - Intergenic
1151945161 17:77315739-77315761 CGGCACAGGCTGGGCCTGGCAGG - Intronic
1152231226 17:79115077-79115099 GGGCAGAGGCAGAGCCGTGGAGG - Intronic
1152479243 17:80538828-80538850 CGGCAAAGACAGAGCCGAGAAGG - Intergenic
1152711161 17:81871092-81871114 GGGCTAGGGCGGGGCCGGGGCGG - Intronic
1152876808 17:82790968-82790990 CGGCAAAGGGAGGGCAACGGCGG - Intronic
1153565579 18:6414661-6414683 CGGCGAGGGCCGGGCCGGTGGGG - Intronic
1154175717 18:12086546-12086568 GGGCTAAGACAGGGCCAGGGTGG - Intergenic
1154177161 18:12093175-12093197 AGCCAAAGGCAGGGCAGGGCAGG + Intergenic
1154415719 18:14174284-14174306 GGGCCAAGACAGGGCCAGGGTGG + Intergenic
1155325216 18:24657898-24657920 CGTCAAAGGCAGGGGCTGAGTGG - Intergenic
1160227507 18:77022360-77022382 CGGAAAAGGCAGGACCAGGTGGG + Intronic
1160500527 18:79399522-79399544 CGGGAGAGGCAGGCCCAGGGCGG + Intronic
1160736069 19:662974-662996 AGGCAAGGCCGGGGCCGGGGTGG - Intronic
1160861454 19:1238776-1238798 CTGCAAGGGCAGAGGCGGGGAGG - Intergenic
1160862123 19:1241898-1241920 CGGCATAGGCACGGGCGTGGCGG - Exonic
1160909956 19:1469789-1469811 CCGCAGTGGCAGGGCCGTGGCGG - Exonic
1160967877 19:1754466-1754488 CGGCACAGGCAGCGGCGGAGCGG + Exonic
1161280188 19:3441688-3441710 GGGCACAGGAAGGGCCGGAGGGG + Intronic
1161450704 19:4343859-4343881 CGGCGGCGGCGGGGCCGGGGCGG + Exonic
1161461543 19:4400498-4400520 CGGCTGAGGCGGCGCCGGGGCGG - Exonic
1161514142 19:4687306-4687328 TGGCAGAGACAGGGCCAGGGTGG + Intronic
1161818815 19:6516699-6516721 CAGCGAGGGCAGGGTCGGGGAGG - Intergenic
1161828858 19:6588374-6588396 TGGCAAAGGCCGGGGAGGGGGGG + Intronic
1162341444 19:10093658-10093680 GGGCAGAGGCAGGGAAGGGGAGG - Intronic
1162545298 19:11325436-11325458 CGGGAAAGGCCCGGCCGTGGGGG - Exonic
1163265007 19:16215185-16215207 AGGCTAAGGCGGGGGCGGGGGGG + Intronic
1163521557 19:17794958-17794980 GGGAAGAGGCATGGCCGGGGAGG + Intronic
1163575714 19:18109903-18109925 GGGCAGAGGCCGGGCCGGGGCGG + Intronic
1164644015 19:29844942-29844964 CGGGAGGGGCAGGGCCAGGGCGG + Intergenic
1165809328 19:38601340-38601362 GCACAAAGGCAGGGACGGGGAGG - Intronic
1165903491 19:39179504-39179526 CAGCCAAGGCAGGGCAAGGGTGG + Intronic
1166103152 19:40583249-40583271 GGACAAAGGCAGGCCTGGGGTGG + Intronic
1166150937 19:40875569-40875591 CGGGAAAGGAAGGGGCGTGGTGG - Exonic
1166442098 19:42823897-42823919 CAGGAGAGGCAGGGCCCGGGAGG + Intronic
1166461522 19:42992180-42992202 CAGGAGAGGCAGGGCCCGGGAGG + Intronic
1166478815 19:43152165-43152187 CAGGAGAGGCAGGGCCCGGGAGG + Intronic
1166501488 19:43344496-43344518 CAGGAGAGGCAGGGCCCGGGAGG + Intergenic
1166508628 19:43388962-43388984 CAGGAGAGGCAGGGCCCGGGAGG - Intergenic
1166528413 19:43527250-43527272 CGGGAAGGGCGGGGCGGGGGCGG + Intronic
1166857950 19:45792552-45792574 AGGCGGAGGCAGGGCCGGGCGGG + Exonic
1166858003 19:45792765-45792787 CGGCAGTGGCGGGGCCCGGGGGG - Exonic
1166996165 19:46720577-46720599 CGGCCAGGGCAGGGCCAGGTGGG + Exonic
1167745877 19:51351620-51351642 CCAAAAAGGCAGGGCCTGGGTGG - Intronic
1167938097 19:52923549-52923571 CGGCAGACGCGGGGCGGGGGCGG + Intergenic
1168568274 19:57442519-57442541 CGGGAAAGGCAGGGAAAGGGAGG - Intronic
928063312 2:28136724-28136746 GGGTAAAGGCAGGGGAGGGGAGG - Intronic
928239989 2:29577934-29577956 CGGCACTGGCAGGCCCAGGGTGG + Intronic
929551873 2:42898806-42898828 CGGCAGAGTCGGGGCCTGGGGGG - Intergenic
929603805 2:43221387-43221409 CGGCTAAGGCAGGGCCCGGGAGG + Intergenic
930049214 2:47201252-47201274 GGGCAGAGGCAAGGCCGGTGAGG + Intergenic
930700830 2:54456681-54456703 CTGCAAAGCCCGGGCGGGGGCGG + Intronic
932281657 2:70498327-70498349 CAGGAAAGGCAGGGCCCTGGGGG - Intronic
935515083 2:104026649-104026671 CACCAAAGGCAGGGCCCGGTGGG + Intergenic
936447510 2:112607368-112607390 AGGCAAAGGGAGGGGAGGGGAGG - Intergenic
937083809 2:119157997-119158019 CGGGCAAGCCAGGGCCGCGGGGG - Exonic
937291657 2:120785610-120785632 GGGCAGGGGCAGGGCAGGGGTGG - Intronic
937764657 2:125646157-125646179 CGGAAAAGGAGGGGGCGGGGCGG - Intergenic
938069995 2:128303253-128303275 CAGTAAAGGCAGGGCCAGGAGGG + Intronic
938677106 2:133647815-133647837 CGGGAAGGGCAGGGCAGGGCAGG + Intergenic
938921289 2:135997528-135997550 GGGCCCAGGCAGGGCAGGGGTGG + Intergenic
939178819 2:138780959-138780981 CGGAAAAGGCTGGGGCGGGGAGG + Intergenic
941366709 2:164619345-164619367 GGGCAGAGGCTGGGACGGGGTGG - Intronic
943049901 2:182901844-182901866 CTGCAGAGGCAGGGCCTGTGGGG - Intergenic
943669852 2:190649030-190649052 CGGGGAAGGCAGGGGAGGGGAGG + Intronic
946153779 2:217793833-217793855 GGGCTGAGGGAGGGCCGGGGTGG + Intergenic
946692419 2:222319505-222319527 CGGCGGTGGCGGGGCCGGGGTGG + Intergenic
947524554 2:230870251-230870273 AGGCAGAGGCAGCGCTGGGGCGG + Intronic
947866171 2:233399453-233399475 CAGCCACGGCAGGGCTGGGGAGG + Intronic
947869996 2:233429749-233429771 CGGCAAAGGCAGGCCCGGAGGGG - Intronic
948365200 2:237450235-237450257 AGGGAAAGGCAGGCCCAGGGAGG + Intergenic
948373110 2:237503261-237503283 CTGCCAAGGCAGGGCCTGGAGGG + Intronic
948503567 2:238411825-238411847 CGGGGAAGGCAGGATCGGGGGGG + Intergenic
948623110 2:239249175-239249197 CAGCAAGGGCAAGGCCTGGGAGG + Intronic
948939892 2:241190439-241190461 AGGCAAAGGCAAGACCAGGGCGG + Intronic
949004577 2:241637831-241637853 CGGGCCAGGCTGGGCCGGGGCGG + Intronic
949049697 2:241890897-241890919 CGGCACCGACAGGCCCGGGGGGG + Intergenic
1169345020 20:4822880-4822902 CGGCAGGTGCAGGGCTGGGGAGG - Intronic
1169393066 20:5205882-5205904 CAGCAAAGGCAGAGGCAGGGCGG + Intergenic
1170859684 20:20091085-20091107 GGGCAGTGGGAGGGCCGGGGTGG - Intronic
1171492689 20:25532401-25532423 CTGCAAAGACAGGGCCAGAGGGG - Intronic
1171782030 20:29427957-29427979 CGCCAGGGGCAGGGCAGGGGGGG - Intergenic
1171880996 20:30617247-30617269 CGGTAAAGGAAGGGCCAGAGTGG - Intergenic
1172104450 20:32508254-32508276 CAGCAAAGGCAGGCCAGGGTGGG - Intronic
1172118326 20:32584207-32584229 CGGGACAGGCAGCCCCGGGGCGG + Intronic
1172444954 20:34988027-34988049 GGGGAAAGGGAGGCCCGGGGAGG - Intronic
1172884444 20:38221948-38221970 CGGGAAAGGCAGGGCCGGGTAGG + Intronic
1172993442 20:39052408-39052430 GGGCAGGGGCAGGGGCGGGGGGG + Intergenic
1173657081 20:44706794-44706816 TGGCAAAGGCAGGGGCAGCGTGG + Intergenic
1173869087 20:46330553-46330575 TGCCAAAGGCAGGGCAGGGATGG - Intergenic
1174291337 20:49510996-49511018 GGGCCAGGGCAGGGCCAGGGTGG - Intronic
1174828442 20:53790790-53790812 GAGCAAATGCAGGGGCGGGGGGG - Intergenic
1174959517 20:55139478-55139500 CGGCAAGGGCAGGGAAGGGAAGG - Intergenic
1175224960 20:57439403-57439425 GGACAAAGGCAGGGCCGAGCTGG - Intergenic
1175721243 20:61288747-61288769 CGGCAACGTCAGCGCCGGGCAGG - Intronic
1175774531 20:61644657-61644679 GGGCAAAGCCAGGGCCAGAGGGG + Intronic
1175939439 20:62531292-62531314 AGGGAAGGGCAGGGCCGTGGTGG - Intergenic
1176024118 20:62977259-62977281 GGGGCAAGGCAGGGCGGGGGAGG - Intergenic
1176103220 20:63373921-63373943 CGGCACAGGCACAGCCAGGGTGG + Intronic
1176114282 20:63424323-63424345 CAGAAAAGGCTGGGCAGGGGTGG + Intronic
1176297575 21:5082414-5082436 GGGCATAGGCAGGTCCAGGGAGG - Intergenic
1176551405 21:8224040-8224062 CGGCAAAGGCCAGCCGGGGGAGG - Intergenic
1176570314 21:8407039-8407061 CGGCAAAGGCCAGCCGGGGGAGG - Intergenic
1176578223 21:8451226-8451248 CGGCAAAGGCCAGCCGGGGGAGG - Intergenic
1176856608 21:13979971-13979993 CGGCGGGGGCAGGGGCGGGGAGG - Intergenic
1176857620 21:13985020-13985042 GGGCCAAGACAGGGCCAGGGTGG - Intergenic
1176866988 21:14059207-14059229 GGGCCAAGACAGGGCCAGGGTGG + Intergenic
1179859454 21:44179534-44179556 GGGCATAGGCAGGTCCAGGGAGG + Intergenic
1179909782 21:44441641-44441663 GGGCAGAGGCAGGGCTGGCGGGG + Intronic
1180891464 22:19291827-19291849 GGGCAGAGGCGGGGCAGGGGCGG - Intergenic
1181174821 22:21029451-21029473 AGGCAGAGGCAGGGCAGGGCTGG + Intronic
1181670968 22:24425265-24425287 CGGCCAAAGCAGGGCCAGTGAGG - Intronic
1181939202 22:26462353-26462375 CTGCAAGGGCAGGGCAGTGGGGG + Intronic
1182120901 22:27786035-27786057 CTGCAAAGGCAAGGCCTTGGTGG + Intronic
1183216291 22:36482150-36482172 GGGCGAAGGCGGGGGCGGGGCGG + Intergenic
1183393915 22:37560911-37560933 GGGGGAAGGAAGGGCCGGGGCGG + Intronic
1183396110 22:37571789-37571811 CGGAATAGGCAGGGCGGGTGGGG - Intronic
1183508638 22:38222682-38222704 GGGCAAAAGCAGGGCAAGGGGGG + Intronic
1183736019 22:39645400-39645422 CTGCAGAGGCAGGGGCGGGTAGG + Intronic
1183976156 22:41513542-41513564 AGGCACGGGGAGGGCCGGGGAGG - Intronic
1184795128 22:46727833-46727855 CGGGGGTGGCAGGGCCGGGGGGG - Intronic
1185123824 22:48992693-48992715 TGGGAAAGGGAGGGGCGGGGAGG + Intergenic
1185300874 22:50080173-50080195 CGGCAAAGGCTGGGCTGGGCAGG + Intronic
1185301154 22:50081802-50081824 GGGCCAAGGCTGGGCGGGGGTGG + Intronic
1185347469 22:50316900-50316922 AGGCAAGGACAGGGCGGGGGGGG + Intronic
950305312 3:11912020-11912042 TGGCAAAGGAAGGGGCGGGTCGG + Intergenic
950526638 3:13528322-13528344 GAGGCAAGGCAGGGCCGGGGAGG + Intergenic
951544392 3:23810517-23810539 GGGGAAAAGCAGGTCCGGGGAGG + Intronic
952702243 3:36339705-36339727 CTGGCAAGGCAGGGCTGGGGTGG + Intergenic
953927711 3:46990751-46990773 AGGCAAAGGCATGGGCGTGGGGG + Intronic
954152599 3:48664961-48664983 CTGCAAAGGAAGGGCAGGGAGGG + Intergenic
954457509 3:50607823-50607845 AGGCATAGGCAGGGCCGGGGTGG + Exonic
955060253 3:55487235-55487257 CAGCAAGGGCAGGGCCTGGTCGG + Exonic
961073621 3:123961456-123961478 GGGCCAAGGCATGGCTGGGGCGG + Intergenic
961377277 3:126475493-126475515 GGGCTACGCCAGGGCCGGGGGGG + Exonic
961505470 3:127368305-127368327 TGACAATGGCAGGGCCGGGCTGG - Intergenic
961554879 3:127690800-127690822 GGCCAAGGGCAGGGCTGGGGTGG + Exonic
961634242 3:128322827-128322849 GGGCAAAGGTGGGGACGGGGTGG - Intronic
961818647 3:129564153-129564175 GAGCAGAGGCAGGGCCTGGGAGG - Intronic
964358577 3:155871331-155871353 CGCCGAAGGCAGGGCAGGGTCGG + Intronic
966891313 3:184409485-184409507 CTGGACAGGCAGGCCCGGGGCGG + Intronic
968046226 3:195625065-195625087 CACCAAAGGCAGGGGCGGGGCGG + Intergenic
968308427 3:197665022-197665044 CACCAAAGGCAGGGGCGGGGCGG - Intergenic
968392547 4:205266-205288 CAGCCAAGCCAGGGCCGGGGCGG - Intergenic
968405450 4:336618-336640 CGGCCTAGCCAGGGCCGGGGCGG - Intergenic
968521363 4:1036115-1036137 AGGGAAAGGGAGGGCCGGGAGGG - Intergenic
968605777 4:1534676-1534698 GGGGAAAGGCAGGTCAGGGGAGG - Intergenic
968748261 4:2372342-2372364 CGGCGATGGAAGGGCTGGGGAGG - Intronic
968759773 4:2436778-2436800 GGGCAAAGGCAGGGGTGGAGCGG - Intronic
968843967 4:3029527-3029549 GGGCAGGGGCAGGGCCTGGGAGG - Intronic
969229057 4:5817006-5817028 GGGCAAAGGCAGGGCAGGTTGGG + Intronic
969484734 4:7465959-7465981 GGGCAGGGGCAGGGCCAGGGTGG + Intronic
969498632 4:7540145-7540167 AGGGAGAGGCAGGGGCGGGGAGG - Intronic
969498659 4:7540201-7540223 AGGCAGAGGCAGGGGCAGGGAGG - Intronic
969639705 4:8389432-8389454 GGGCAAAGGCTGGGGTGGGGAGG - Intronic
969851854 4:9963715-9963737 CAGCAAAGGCAGAGGCTGGGAGG + Intronic
970192846 4:13531477-13531499 TGCCAAAGGCAGGGCGGTGGGGG - Intergenic
978195888 4:105971350-105971372 TGGTAAAGGCAGGGCTGGAGGGG + Intronic
981782138 4:148442425-148442447 GGGCAGGGGCAGGGCCAGGGCGG + Exonic
984910532 4:184670240-184670262 TGGCAATGGCAGTGCTGGGGAGG - Intronic
985691692 5:1316481-1316503 AGGCAAAGGCACGGCCTGTGTGG + Intergenic
985727428 5:1523619-1523641 CGGCCGAGGAGGGGCCGGGGAGG - Intronic
985747085 5:1653810-1653832 CACCAAAGGCAGGGGCGGGGCGG - Intergenic
985781178 5:1872590-1872612 GGACAAAGGCAGGGCCTGTGTGG + Intergenic
985957781 5:3277477-3277499 AGGGAAGGGCAGGGCCGGGAAGG + Intergenic
986343292 5:6811174-6811196 CAGCAAAGGCAGGGCCAGACCGG + Intergenic
986928903 5:12794634-12794656 CGCGAAGGGCAGGGCCTGGGGGG + Intergenic
990910212 5:60844433-60844455 CGGCGGAGGCGAGGCCGGGGCGG - Intergenic
991054465 5:62306401-62306423 CGGAAAAGGCGGGGAGGGGGCGG - Intronic
992732811 5:79689799-79689821 CCGCAGGGGCAGGGCTGGGGAGG + Intergenic
997248221 5:132369697-132369719 CGGCGAAGGCGGAGCTGGGGCGG - Intergenic
999076976 5:148805831-148805853 TGGCAAAGGCAGTGTGGGGGCGG + Intergenic
999328325 5:150656908-150656930 CGGTAGAGGAAGGGCCTGGGAGG - Intronic
999723962 5:154419514-154419536 TGGGAAAGGCAGGCCCGGGACGG - Exonic
999989127 5:157033557-157033579 CATCAATGGCAGGGCGGGGGCGG + Intronic
1001403842 5:171462131-171462153 CAGCAAAGGCAGGGATGGAGAGG - Intergenic
1001424528 5:171614779-171614801 ATGTAAGGGCAGGGCCGGGGTGG - Intergenic
1002073806 5:176696416-176696438 TGGGGAAGGCAGGGTCGGGGTGG + Intergenic
1002789496 6:426946-426968 CTGCCAAGGCAGGCCTGGGGTGG + Intergenic
1002817323 6:693047-693069 CGGCACAGACAGGGCCCGGTAGG + Exonic
1003290807 6:4776740-4776762 CGGGAGGGGCAGGGTCGGGGCGG - Exonic
1003921451 6:10837488-10837510 CGGGAATTGAAGGGCCGGGGAGG + Intronic
1004194001 6:13487775-13487797 CGGCCTGGGCGGGGCCGGGGAGG - Intergenic
1004341629 6:14813029-14813051 CGGCAGAGGAATGGACGGGGTGG - Intergenic
1005510635 6:26508956-26508978 AGGCAAAAGAAGGGCCGGAGGGG - Exonic
1006558489 6:34889270-34889292 GGGAAAAGGCAGGGAGGGGGTGG + Exonic
1006903276 6:37516566-37516588 CTGCAGAGGCAGGGAGGGGGAGG - Intergenic
1007287462 6:40758013-40758035 CACCAAAGCCAGGGCCAGGGAGG + Intergenic
1007305105 6:40897639-40897661 CGGCAAAGGCAGAGTGTGGGTGG - Intergenic
1007727326 6:43924343-43924365 TGGCAGAGGCAGGGCTGCGGAGG - Intergenic
1007967648 6:46016417-46016439 CGGGCAGGGCAGGGCAGGGGTGG + Intronic
1009266091 6:61556284-61556306 TGGCAATGGCAGTGCAGGGGTGG + Intergenic
1010243682 6:73642279-73642301 AGGGGGAGGCAGGGCCGGGGGGG - Intronic
1010840286 6:80641874-80641896 TGGCAAGGGCAGGGCTGAGGTGG - Intergenic
1016597087 6:145814817-145814839 CGGCAGAAGCCGGGCCGGGTGGG - Intergenic
1018764908 6:166925507-166925529 AGGCAAGGGCTGGACCGGGGAGG - Intronic
1018813741 6:167316403-167316425 GGGCAGGGGTAGGGCCGGGGAGG - Intergenic
1019146159 6:169976751-169976773 GGGCACAGGGGGGGCCGGGGGGG + Intergenic
1019341271 7:510231-510253 CGGGAAAGGCAGGGCCGGCCGGG - Intronic
1019387295 7:764560-764582 CGGGAGCGGGAGGGCCGGGGAGG - Intronic
1019437016 7:1027755-1027777 CGGCACAGGGAGGGGCGAGGCGG + Intronic
1019493173 7:1324471-1324493 GGGCACAGGCAGGGGCTGGGAGG + Intergenic
1020073068 7:5240220-5240242 CAGGAAAGGCAGGGCGGGGGCGG - Intergenic
1020280318 7:6646976-6646998 GGAGAAAGGCAGGGCAGGGGAGG - Intronic
1022515783 7:30974309-30974331 CTGCAAAGGCAGGGCCAGGCAGG - Intronic
1024257308 7:47548593-47548615 AGGCAAAGGCAGGACCAGTGAGG - Intronic
1024972001 7:55079152-55079174 CCGCTAAGGCTGGGCGGGGGCGG + Intronic
1026828509 7:73597780-73597802 AGGGCAAGGCAGGGCAGGGGAGG - Intronic
1027051556 7:75024556-75024578 CCTCCAGGGCAGGGCCGGGGTGG + Intronic
1027151934 7:75739206-75739228 CGTTCTAGGCAGGGCCGGGGCGG + Intergenic
1027232452 7:76280663-76280685 AGGCAGAGGCAGGGCAGGCGCGG + Intronic
1029151583 7:98484158-98484180 CGTCAAGGGCAGGACTGGGGTGG - Intergenic
1029438422 7:100574845-100574867 GGGCAGGGGCAGGGCCGGCGGGG + Exonic
1031100997 7:117479752-117479774 CGGGAAAGGGAGGTGCGGGGCGG + Intronic
1034182195 7:149147612-149147634 CGGGGAAGGCAGGGCCGGGTCGG + Exonic
1034243125 7:149624663-149624685 CGGCAGAGACAGGGCTGGGCGGG - Intergenic
1034259394 7:149745350-149745372 CAGCAAGGGAAGGGCCGGGCTGG + Intergenic
1034735906 7:153429447-153429469 CTGAAAAGTCAGGGCCAGGGTGG + Intergenic
1035361548 7:158316804-158316826 CGGCACAGGTAGGGCGGGCGTGG - Exonic
1036776731 8:11617898-11617920 AGCCACAGGCAGGGCGGGGGAGG + Intergenic
1037467242 8:19172604-19172626 CGGGAAAGGAAGGGAAGGGGAGG + Intergenic
1037839114 8:22231642-22231664 TGCCAAAGGCCTGGCCGGGGGGG + Intronic
1038727681 8:30095662-30095684 GGCCAAGCGCAGGGCCGGGGCGG - Intronic
1039846716 8:41330622-41330644 ATGCAAAGGCAGAGCAGGGGTGG + Intergenic
1039921795 8:41898028-41898050 GGGCAAAGACAGGGTTGGGGGGG - Intergenic
1039961401 8:42250618-42250640 GGCCAAAGACAGGGCCGGGAGGG + Intergenic
1039964083 8:42271406-42271428 CGGGGAAGGCGGGGCTGGGGCGG - Exonic
1040545790 8:48396987-48397009 AGGTGAAGGCAGGGCGGGGGCGG - Intergenic
1041098544 8:54373498-54373520 CTGGAAAGGCAGGCCTGGGGAGG + Intergenic
1041646222 8:60255246-60255268 CGGGAAAGGTAGGGCGGTGGGGG - Intronic
1041673601 8:60516815-60516837 CGGGCAAGGCAGGCGCGGGGCGG + Intergenic
1042865026 8:73349454-73349476 AGGCAACGGCAGGGGCAGGGTGG - Intergenic
1045112712 8:98949203-98949225 GGTAAAAGGCAGGGCCGGGAAGG - Exonic
1045411850 8:101927842-101927864 AGCCAAAGTCAGGGCCTGGGTGG + Intronic
1048033087 8:130651424-130651446 GGTCAGAGGCAGGGCAGGGGTGG + Intergenic
1049206799 8:141367314-141367336 GGGCAAAGGCAGGGTGGGGGCGG + Intergenic
1049228552 8:141470110-141470132 AGGCAGAGGCAGGGCCGGGAAGG - Intergenic
1049238596 8:141525244-141525266 CGGCAAGGCTGGGGCCGGGGCGG + Intergenic
1049385410 8:142340658-142340680 TGGGAAAGGCAGGGCCTGGTGGG + Intronic
1049397800 8:142409671-142409693 CTGCAGAGGCAGGGCCAGGAGGG - Intergenic
1049801493 8:144519781-144519803 CAGCAAGGGCAGGGCCTGGCAGG - Exonic
1053138279 9:35665244-35665266 CCGCGGAGGCGGGGCCGGGGAGG + Exonic
1053138307 9:35665366-35665388 CGGCCAAGGCAGGGCAGGGCAGG + Intronic
1053187166 9:36026360-36026382 TGGGAAAGGCAGGGCAGGGGTGG - Intergenic
1053381155 9:37650736-37650758 CGGCGGAGGCAGGGCCCGGGTGG + Intronic
1053421889 9:37984912-37984934 CGGCAAGGGCAAGGCAGGGCAGG + Intronic
1053896181 9:42743180-42743202 CGGAAAAGGCAGGTCTGAGGAGG + Intergenic
1055985760 9:82055832-82055854 AGGCAAAGGAAGGGCCAGAGTGG + Intergenic
1056524185 9:87427421-87427443 GGGCAGGGGCAGGGCGGGGGTGG + Intergenic
1056611301 9:88127657-88127679 AGGCAAAGGAAGGGCCAGAGTGG + Intergenic
1057213498 9:93214704-93214726 CAGCAAAGAGAGGGCGGGGGGGG - Intronic
1057308423 9:93925955-93925977 CAGAAAGGGCAGGGCTGGGGCGG - Intergenic
1057478639 9:95426795-95426817 CCGCGCAGGCAGGGCCGGGCCGG - Intergenic
1059064302 9:111066429-111066451 AGGCCAAGGCAGGGCAGGGGTGG - Intergenic
1060220460 9:121761606-121761628 CTGCAAGTGCAGGGCTGGGGCGG + Intronic
1060522084 9:124299662-124299684 AGGCAGAGGCAGGGGTGGGGAGG + Intronic
1060656308 9:125374864-125374886 CAGCAAAGCCGGGGCCTGGGAGG - Intergenic
1061348135 9:130043030-130043052 GGGCAAAGGGATCGCCGGGGAGG - Exonic
1061370596 9:130195379-130195401 GGGCCAAGGCAGGGTCGGGAGGG + Intronic
1061483536 9:130908925-130908947 CCCCAAAGGCAGGGTTGGGGTGG - Intronic
1062286412 9:135774946-135774968 CTGCAAGGCCAGGGCTGGGGAGG - Intronic
1062334282 9:136058227-136058249 GGGCAAAGGCAGGGCGAGGTTGG - Intronic
1062372665 9:136248025-136248047 CATCTAAGGCAGGGCGGGGGAGG + Intergenic
1062437058 9:136551036-136551058 CGGCAGAGGCAGTGCCTGGCTGG + Intergenic
1203472584 Un_GL000220v1:122684-122706 CGGCAAAGGCCAGCCGGGGGAGG - Intergenic
1185478225 X:427820-427842 TGGAAAACGCGGGGCCGGGGCGG - Intergenic
1185569973 X:1127529-1127551 CTGCAAGGACAGGGACGGGGAGG + Intergenic
1186479371 X:9884207-9884229 AGGCCAAGGCAGGGTCTGGGAGG - Intronic
1187068177 X:15861467-15861489 TGGCAAAAGCAGGTCTGGGGAGG - Intergenic
1189247697 X:39576305-39576327 AGGCACAGGCATGGCAGGGGAGG - Intergenic
1190108002 X:47572931-47572953 TGGCTAAGGCTGGGCCTGGGCGG + Exonic
1191110602 X:56800753-56800775 CTGCAAAAGCAGGGTCGGGTGGG + Intergenic
1191866246 X:65706208-65706230 GGGCCAAGGCAGGGCAGGGCAGG - Intronic
1192138801 X:68630556-68630578 GGGGAAAGGCAGGGAAGGGGAGG + Intergenic
1192146983 X:68688737-68688759 GGGGAAAGGCAGGGAAGGGGAGG - Intronic
1195683092 X:107563329-107563351 TGGCAGAGGCAGGGCCAGGGAGG - Intronic
1195731984 X:107977642-107977664 ATGGAAAGGCAGGGCAGGGGTGG - Intergenic
1196732574 X:118955849-118955871 CACCAAAGGCTGGGCTGGGGAGG - Intergenic
1196791408 X:119468366-119468388 CGTCGGAGGCGGGGCCGGGGCGG - Intergenic
1196950476 X:120871474-120871496 CAGCAAGGGCTGGGCTGGGGAGG - Intergenic
1197732557 X:129823699-129823721 CTGCAATGGGAGGCCCGGGGAGG + Exonic
1198005519 X:132489483-132489505 TGGCAAAGGCCGGGCGGGGTTGG - Intronic
1199594062 X:149492999-149493021 GAGAAAAGGCAGGGCAGGGGTGG + Intronic
1199947852 X:152682041-152682063 CAGAAAAGGCAGGGCAGGGCTGG - Intergenic
1199961827 X:152786413-152786435 CAGAAAAGGCAGGGCAGGGCTGG + Intergenic
1200039232 X:153353735-153353757 CGGCAAGGGCTGGGCCAGGCCGG - Intronic
1200098353 X:153674555-153674577 TGGCAGGGGCAGGGCGGGGGAGG - Intronic
1200127092 X:153820783-153820805 CGCCAGATGCAGGGCTGGGGAGG - Intronic
1201065774 Y:10092798-10092820 GAGCAGAGGCAGGGCGGGGGCGG + Intergenic