ID: 1132548944

View in Genome Browser
Species Human (GRCh38)
Location 16:546454-546476
Sequence AACTCAGGACCAGGTCGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 86}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132548944_1132548956 16 Left 1132548944 16:546454-546476 CCAGGACGACCTGGTCCTGAGTT 0: 1
1: 0
2: 0
3: 11
4: 86
Right 1132548956 16:546493-546515 CTATCTGCCGTCCACAGGCCTGG 0: 1
1: 0
2: 0
3: 11
4: 101
1132548944_1132548954 11 Left 1132548944 16:546454-546476 CCAGGACGACCTGGTCCTGAGTT 0: 1
1: 0
2: 0
3: 11
4: 86
Right 1132548954 16:546488-546510 CCCTGCTATCTGCCGTCCACAGG 0: 1
1: 0
2: 0
3: 10
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132548944 Original CRISPR AACTCAGGACCAGGTCGTCC TGG (reversed) Intronic
900530588 1:3151088-3151110 ATCTCAGGACCAGGAGGCCCAGG - Intronic
900794112 1:4697753-4697775 AGCTCCTGTCCAGGTCGTCCTGG - Intronic
901809010 1:11755418-11755440 AACTCAGGACCCAGTTCTCCAGG + Intergenic
902110232 1:14072329-14072351 GACTCAGAACCAAGTCCTCCTGG - Intergenic
904828339 1:33289980-33290002 AACTGAGGAACAGGTGTTCCTGG + Intronic
905028207 1:34865551-34865573 AACCCAGGACCAGGGCGCCTGGG - Exonic
905626318 1:39492291-39492313 AGCTCATGACCAGGTCGGCGCGG - Exonic
905670577 1:39788164-39788186 AGCTCATGACCAGGTCGGCGCGG + Exonic
906107087 1:43301025-43301047 ACCCCAGGCCCAGCTCGTCCTGG + Exonic
911397146 1:97324525-97324547 AACTAAGGACCTGCTCGGCCAGG - Intronic
920252122 1:204628822-204628844 AACTCAGCACCAGCTCCTCCTGG + Intronic
923721589 1:236471680-236471702 AACTCAAGACCTGGTTATCCCGG + Intronic
1063932837 10:11046367-11046389 AACTCTGGGCCAAGTCGTCTAGG - Intronic
1067944737 10:50682677-50682699 AACTCAGGGCCACGAGGTCCAGG - Intergenic
1068803799 10:61172245-61172267 AACTCAGGTGCAGGTGGCCCAGG - Intergenic
1069618934 10:69824461-69824483 AAGTCAGGCTCAGGTAGTCCTGG + Intronic
1070866239 10:79709548-79709570 AACTCAGGGCCACGAGGTCCAGG - Intronic
1070880033 10:79847679-79847701 AACTCAGGGCCACGAGGTCCAGG - Intronic
1071633145 10:87231769-87231791 AACTCAGGGCCACGAGGTCCAGG - Intronic
1071646594 10:87363987-87364009 AACTCAGGGCCACGAGGTCCAGG - Intronic
1073426328 10:103457750-103457772 AGCTGAGGACCAGGGTGTCCTGG - Intronic
1077172922 11:1176398-1176420 ACCACAGGACCAGGGAGTCCGGG - Intronic
1077729389 11:4713438-4713460 AACTCAGAACCAGGTCTGTCAGG - Intronic
1084088742 11:66866595-66866617 AATGCAGGAGCAGGTGGTCCTGG - Intronic
1090838560 11:130471128-130471150 AAGTAGGGACCAGGTCTTCCGGG + Intronic
1091218036 11:133915581-133915603 AAATCATGACCAGGTAGCCCAGG + Intronic
1097812732 12:64036033-64036055 AACTCAAATCCAGGTCTTCCTGG + Intronic
1100656447 12:96650854-96650876 TGCTCAGGACCAGCTCTTCCAGG - Intronic
1104045154 12:125157189-125157211 CACTCAGGACCAGGTGGACAGGG - Intergenic
1104098876 12:125587514-125587536 ATCACAGGACCAGGTGGTCCTGG + Intronic
1107989822 13:45810008-45810030 GACTCAGGACTAGCTCGACCAGG - Intronic
1111347206 13:86974509-86974531 AGCTCTGGACCAGGGCATCCTGG + Intergenic
1112054600 13:95677925-95677947 AACTCAGTGCCTGGCCGTCCGGG - Intronic
1115131333 14:30055709-30055731 AACTCAGGACCAGACTGCCCAGG + Intronic
1119702897 14:76767470-76767492 AACTCAGGACTAGGGGTTCCTGG + Intronic
1121553632 14:94820353-94820375 AAATCAGGACAGGGTTGTCCAGG + Intergenic
1123172555 14:106388409-106388431 AACTCAGCATCATGTCCTCCAGG - Intergenic
1125318600 15:38458540-38458562 AACTCGGGAGCAGGTAGTTCTGG + Intronic
1127719726 15:61687893-61687915 AATACAGGACCAGGTGGTCATGG + Intergenic
1129742946 15:77998829-77998851 AACACAGGCCCAGGCAGTCCTGG + Intronic
1129842533 15:78752617-78752639 AACACAGGCCCAGGCAGTCCTGG - Intergenic
1131507959 15:93032951-93032973 AACGCAGTACCAGGTCCTCTAGG + Intergenic
1132009835 15:98266341-98266363 AACTCAGTACCAGGCCATCCTGG - Intergenic
1132548944 16:546454-546476 AACTCAGGACCAGGTCGTCCTGG - Intronic
1142346580 16:89557930-89557952 AACTCAGGGCCAGGGTGTCCTGG - Intergenic
1145812273 17:27771536-27771558 GACTGATGACCAGGTCGGCCAGG - Intronic
1149335139 17:55627712-55627734 ATCTCAGGCCCAGGTGGTCGAGG - Intergenic
1150165863 17:62942089-62942111 AACTCAGCACCATGTTGTCTGGG + Intergenic
1152430096 17:80244068-80244090 AACTCAGTATCAGGGCATCCCGG - Intronic
1153674607 18:7445742-7445764 ACCTCAGATCCAGGTCTTCCTGG - Intergenic
1158413897 18:57232463-57232485 CATTCAGGACCAGGCCTTCCAGG + Intergenic
1160516952 18:79483957-79483979 ACCTCAGGACCAGGTCACCCTGG - Intronic
1160516975 18:79484045-79484067 ACCCCAGGACCAGGTCACCCTGG - Intronic
1161309096 19:3584209-3584231 AACTCAAGACCAGGAGGTTCAGG - Intergenic
1162323647 19:9985840-9985862 ACCTTAGGTCCAGGGCGTCCTGG + Exonic
1163830287 19:19544285-19544307 AAGGCAGGACCAGCTCGCCCAGG - Exonic
930087809 2:47510292-47510314 AACTCTGGAGCAGGTGGTCTGGG - Intronic
941489871 2:166129990-166130012 GACTCAGGACCAGGTGGACCAGG + Intergenic
942042886 2:172082643-172082665 ACCTCAGGACCAGGAGGTCCTGG - Intergenic
943524303 2:188997198-188997220 ACCTGAGGGCCAGGTCCTCCAGG - Exonic
1172397496 20:34619304-34619326 AACTCAGAACCAGGTCACTCTGG + Intronic
1172612318 20:36261231-36261253 AACCAGGGACCAGGTTGTCCAGG + Intronic
1173174016 20:40750735-40750757 AACTCATGCCCAGGTCCTCTAGG + Intergenic
1173438911 20:43057726-43057748 AACTCAGAACCTGGTGGTCCAGG - Intronic
1181560550 22:23697230-23697252 CACTCACATCCAGGTCGTCCGGG - Exonic
1184818227 22:46888505-46888527 CACTCAGGACCAGGCCCTCATGG - Intronic
1184976921 22:48068866-48068888 ATCTCAGGATGAGATCGTCCTGG - Intergenic
1185149228 22:49154566-49154588 AACGCAGGACAAGGACTTCCAGG + Intergenic
953263901 3:41367432-41367454 AACTCTGGACTGGGTTGTCCTGG - Intronic
956605419 3:71068479-71068501 AACTGAGGACCACGTGGGCCAGG - Intronic
960457478 3:117890618-117890640 AACCCAGGACAAGATTGTCCTGG - Intergenic
960995712 3:123338920-123338942 AACTCAGCACCTGGGTGTCCAGG - Intronic
961355877 3:126339730-126339752 GCCTCAGGACCAGGGCTTCCAGG - Intergenic
962973897 3:140429530-140429552 AACTGAGGACCAGGTCATGGAGG + Intronic
964401752 3:156306819-156306841 AACTGAGGACCATGTGGTCTGGG + Intronic
964644552 3:158944487-158944509 AACACAGGCCCTGGTCTTCCTGG - Intergenic
967388920 3:188936546-188936568 AACTTGGGACCAGATCATCCTGG - Intergenic
977480749 4:97571633-97571655 AACTCAAGACAAGGACTTCCAGG - Intronic
978308721 4:107361886-107361908 AGCTCAGGACCAGGTTGTTCAGG + Intergenic
999295585 5:150457782-150457804 AACTGTGGCCCAGGTGGTCCTGG + Intergenic
999722974 5:154412511-154412533 GACTCAGGTGCAGGTGGTCCAGG - Intronic
1019338084 7:494526-494548 ACCTCAGGACCAGGACTTCCTGG + Intergenic
1019604697 7:1902632-1902654 CACGCAGAACCAGGTCGGCCGGG + Intronic
1027339673 7:77192394-77192416 AACTCAGGAGCTGGCCTTCCTGG - Intronic
1033086397 7:138345823-138345845 AACCCAGCACCAGGTCGTTGAGG - Intergenic
1034520655 7:151616932-151616954 TACTCAGGACCAGATCGCCAAGG + Intronic
1034554200 7:151839676-151839698 AAGTCAGGACCAGGTGTCCCTGG - Intronic
1035818149 8:2562482-2562504 AACTCAGGAGAAGGTCGCCGTGG + Intergenic
1039702826 8:39979114-39979136 AGCTCAGGACCAGGTGGGCCAGG - Exonic
1040512234 8:48105632-48105654 AAGTCTGGACCAGCTCATCCAGG - Intergenic
1042670378 8:71256415-71256437 CACTCAGGACAAGGTCCTCAAGG - Intronic
1047439875 8:124868144-124868166 AAATCAGGGCCAGGGTGTCCAGG - Intergenic
1048948774 8:139475522-139475544 AACTCTGGGCCAGGTCTACCAGG + Intergenic
1061350060 9:130057008-130057030 AACTCAGAACAAGCTTGTCCAGG - Intronic
1189120651 X:38390856-38390878 AACTCTGCACCAGGTTTTCCTGG + Intronic
1191257330 X:58285309-58285331 AACTAAGGTCAAGGTCTTCCTGG - Intergenic
1193289548 X:79755298-79755320 AACTTAGGACAAGGTACTCCTGG - Intergenic
1201688806 Y:16738243-16738265 AACTCAGCACCAGGTTTTCTGGG - Intergenic