ID: 1132550271

View in Genome Browser
Species Human (GRCh38)
Location 16:551188-551210
Sequence ACTGGGGACCCTCACCGACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 8, 2: 8, 3: 15, 4: 113}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132550271_1132550291 30 Left 1132550271 16:551188-551210 CCCGGTCGGTGAGGGTCCCCAGT 0: 1
1: 8
2: 8
3: 15
4: 113
Right 1132550291 16:551241-551263 GGTCGGTGAGGGTCCCCTGTCGG 0: 5
1: 4
2: 10
3: 8
4: 90
1132550271_1132550286 18 Left 1132550271 16:551188-551210 CCCGGTCGGTGAGGGTCCCCAGT 0: 1
1: 8
2: 8
3: 15
4: 113
Right 1132550286 16:551229-551251 GTGAGGGTCCCCGGTCGGTGAGG 0: 4
1: 5
2: 6
3: 12
4: 86
1132550271_1132550276 -8 Left 1132550271 16:551188-551210 CCCGGTCGGTGAGGGTCCCCAGT 0: 1
1: 8
2: 8
3: 15
4: 113
Right 1132550276 16:551203-551225 TCCCCAGTCGGTGAGGGTCCCGG 0: 1
1: 2
2: 6
3: 15
4: 147
1132550271_1132550285 13 Left 1132550271 16:551188-551210 CCCGGTCGGTGAGGGTCCCCAGT 0: 1
1: 8
2: 8
3: 15
4: 113
Right 1132550285 16:551224-551246 GGTCAGTGAGGGTCCCCGGTCGG 0: 1
1: 2
2: 10
3: 13
4: 136
1132550271_1132550287 19 Left 1132550271 16:551188-551210 CCCGGTCGGTGAGGGTCCCCAGT 0: 1
1: 8
2: 8
3: 15
4: 113
Right 1132550287 16:551230-551252 TGAGGGTCCCCGGTCGGTGAGGG 0: 3
1: 4
2: 7
3: 4
4: 66
1132550271_1132550282 9 Left 1132550271 16:551188-551210 CCCGGTCGGTGAGGGTCCCCAGT 0: 1
1: 8
2: 8
3: 15
4: 113
Right 1132550282 16:551220-551242 TCCCGGTCAGTGAGGGTCCCCGG 0: 1
1: 0
2: 4
3: 11
4: 146
1132550271_1132550280 1 Left 1132550271 16:551188-551210 CCCGGTCGGTGAGGGTCCCCAGT 0: 1
1: 8
2: 8
3: 15
4: 113
Right 1132550280 16:551212-551234 GGTGAGGGTCCCGGTCAGTGAGG 0: 2
1: 8
2: 7
3: 30
4: 162
1132550271_1132550281 2 Left 1132550271 16:551188-551210 CCCGGTCGGTGAGGGTCCCCAGT 0: 1
1: 8
2: 8
3: 15
4: 113
Right 1132550281 16:551213-551235 GTGAGGGTCCCGGTCAGTGAGGG 0: 2
1: 8
2: 8
3: 12
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132550271 Original CRISPR ACTGGGGACCCTCACCGACC GGG (reversed) Intronic
900094878 1:936293-936315 ACCGGGGACCCCCTCCGTCCAGG - Intronic
900094927 1:936410-936432 ACCGGGGACCCCCTCCGTCCAGG - Intronic
900647597 1:3715981-3716003 ACGGGGGACTCTCAACGGCCTGG - Intronic
902404237 1:16174302-16174324 TCTGGGAGTCCTCACCGACCTGG - Intergenic
905936241 1:41826565-41826587 AGTGGGGGCCCTCACAGACAGGG + Intronic
907497578 1:54855014-54855036 ACTGGGGACCCTCAGGAACATGG - Intronic
909368015 1:74850830-74850852 ACTTGGGACCCTTCCAGACCTGG + Intergenic
917524940 1:175780263-175780285 GCTGGGCACCCTAACAGACCAGG - Intergenic
918970478 1:191409551-191409573 ACTGGGGAACATAACCTACCTGG - Intergenic
922402111 1:225270291-225270313 AATGGGGAACCTCACACACCGGG + Intronic
924314284 1:242779517-242779539 ATTGGTGACACTCACTGACCAGG - Intergenic
1066313691 10:34222626-34222648 CTTGGGGACGCTCACAGACCTGG - Intronic
1067476116 10:46567550-46567572 ACTGGGGACCCCCTCCTATCTGG - Intergenic
1067686428 10:48468759-48468781 ACTAGGGATCCTCACTGGCCTGG - Intronic
1070803308 10:79256015-79256037 AGTGGGGACCCTCTGCCACCAGG - Intronic
1070923831 10:80205324-80205346 GCTCGGGACCCTCACTCACCTGG + Exonic
1073115560 10:101089747-101089769 ACTGGGGAGCCTCCCCGAGTGGG - Exonic
1073491654 10:103856381-103856403 CCTGGGGACCCTCCCCAAGCTGG + Intergenic
1073574190 10:104608127-104608149 TCTGGGGACCCCCTCCCACCTGG - Intergenic
1073574728 10:104612871-104612893 TCTGGGGACCCCCTCCCACCTGG - Intergenic
1075463085 10:122631733-122631755 CCTGGGGACCCTCGCCGAGGGGG + Intronic
1076655004 10:132018094-132018116 GCTGGGGACCCACAGCGATCTGG + Intergenic
1077010224 11:376344-376366 GCTGCGGACACTCACCGTCCGGG - Exonic
1077295746 11:1825509-1825531 ACTGGGGCCCCCCACCTGCCTGG - Intergenic
1079108058 11:17586578-17586600 GCTTGGGACCCTCACTTACCAGG - Exonic
1084424746 11:69078559-69078581 CCTGGGGAACCTCATCGCCCTGG + Exonic
1091281174 11:134382736-134382758 ACTTGTCACCCTCAACGACCTGG - Exonic
1092112276 12:5972043-5972065 TCTAGGGACCCTCACTGACCGGG + Intronic
1099009271 12:77272272-77272294 TCTGGGGACCCCCTCCTACCTGG + Intergenic
1104479620 12:129096254-129096276 ACTCGGGACCCAGACCGGCCTGG - Intronic
1106827810 13:33542928-33542950 ACTCGGGTCCCTCCCCGTCCAGG - Intergenic
1113672076 13:112182376-112182398 ACTGTGGGCCCTCACAGCCCTGG - Intergenic
1124620902 15:31273383-31273405 ACTGCAGCCCCTCTCCGACCTGG + Intergenic
1126113116 15:45187192-45187214 ACTGGTGACCCTCCCCCTCCCGG - Intronic
1129467320 15:75731395-75731417 ACTGGCGCCCCTCACTGCCCTGG + Intergenic
1130981923 15:88818428-88818450 ACTGAGGACACACACCTACCAGG - Intronic
1132550059 16:550630-550652 ACAGGGAACCCTCACTGACAGGG - Intronic
1132550065 16:550647-550669 ACCGGGGACCCTCACCGACAGGG - Intronic
1132550071 16:550664-550686 ACTGGGGGCCCTCACCGACCGGG - Intronic
1132550084 16:550697-550719 ACAGGGGACCCTCACCGACCGGG - Intronic
1132550090 16:550714-550736 GACGGGGACCCTCACCGACAGGG - Intronic
1132550102 16:550746-550768 GCAGGGGACCCTCACCGACCGGG - Intronic
1132550116 16:550779-550801 GACCGGGACCCTCACCGACCGGG - Intronic
1132550128 16:550811-550833 ACGGGGCACCCTCACCGACCGGG - Intronic
1132550141 16:550844-550866 GACCGGGACCCTCACCGACCGGG - Intronic
1132550146 16:550860-550882 ACAGGGGACCCTCACCGACCGGG - Intronic
1132550159 16:550893-550915 GACCGGGACCCTCACCGACCAGG - Intronic
1132550162 16:550909-550931 AAAGGGGACCCTCACTGACCGGG - Intronic
1132550168 16:550926-550948 ACAGGGGACCCTCACCGAAAGGG - Intronic
1132550180 16:550959-550981 ACAGGGGACCCTCACCGACCGGG - Intronic
1132550192 16:550992-551014 ACAGGGGACCCTCACCGACCGGG - Intronic
1132550213 16:551041-551063 ACCGGGGACCCTCACCGACCGGG - Intronic
1132550233 16:551090-551112 ACCGGGGACCCTCACCGACCGGG - Intronic
1132550239 16:551107-551129 AACAGGGGCCCTCACCGACCGGG - Intronic
1132550252 16:551139-551161 ACGGGGCGCCCTCACCGACCGGG - Intronic
1132550271 16:551188-551210 ACTGGGGACCCTCACCGACCGGG - Intronic
1132550283 16:551221-551243 ACCGGGGACCCTCACTGACCGGG - Intronic
1132550289 16:551238-551260 ACAGGGGACCCTCACCGACCGGG - Intronic
1136777737 16:32880727-32880749 CCTGGGGGCCCTCACAGCCCTGG - Intergenic
1136892886 16:33980787-33980809 CCTGGGGGCCCTCACAGCCCTGG + Intergenic
1140021123 16:71239832-71239854 AAGGGGGAGCCTCACAGACCAGG + Intergenic
1203080153 16_KI270728v1_random:1142836-1142858 CCTGGGGGCCCTCACAGCCCTGG - Intergenic
1146039044 17:29433785-29433807 TCTGGGGACCCTCTCCCACCTGG + Intronic
1147604989 17:41769399-41769421 AGCAGGGACCCTCACAGACCGGG + Exonic
1150337536 17:64341615-64341637 ACTGGAGACCCTCACTCACCAGG + Exonic
1152374309 17:79911108-79911130 ACTGAGGGCCCTCACCCACGCGG - Intergenic
1152717991 17:81909060-81909082 ACTGGGGACCCCAGCCCACCCGG + Intronic
1156228354 18:35130735-35130757 AATGGGGATCCTCAGAGACCAGG + Intronic
1156479574 18:37427527-37427549 TCTGGGGACCCTTACAGCCCTGG + Intronic
1159134927 18:64326439-64326461 TCTGGGGACCCCCTCCCACCTGG + Intergenic
1161695624 19:5766051-5766073 CCGGGTGACCCTCACTGACCTGG + Intronic
1162274177 19:9639924-9639946 AGTGGGGGCCCTCACAGACAGGG + Intronic
1162408821 19:10492199-10492221 ACTGGTGACCCTCATCAGCCGGG - Exonic
1163038061 19:14583182-14583204 ACTGGGTACCCGGACCCACCAGG + Exonic
1163266371 19:16224843-16224865 GCTCGGGACCCTCACTGGCCGGG - Intronic
1164912930 19:32026989-32027011 CCTGGGGACCACCACCAACCAGG - Intergenic
1164965230 19:32477647-32477669 ACTGGGGAGCCTCACCGCTCTGG - Exonic
1166346838 19:42171713-42171735 ACTGGGGACCCTCCCCCACCCGG - Intronic
1167638133 19:50667014-50667036 CCTGGGGACCCCCATCCACCAGG - Exonic
942045069 2:172095286-172095308 ACTGGGGACCCTCCCCAAAAGGG + Intergenic
942075330 2:172352095-172352117 ACTTGAGACCCTCATCGGCCAGG + Intergenic
942623253 2:177871330-177871352 ACTGGTGACCTTCACGAACCTGG - Intronic
943077157 2:183209453-183209475 ACTGGGGACCATCCCAGACTGGG - Intergenic
943258563 2:185629161-185629183 TCTGGGGACCCCCTCCCACCTGG + Intergenic
944073087 2:195695146-195695168 TCTGGGGACCCCCTCCCACCTGG + Intronic
944683994 2:202101739-202101761 CCTGGAGACCCTCACTGTCCAGG - Intronic
947227910 2:227857808-227857830 TCTGGGGACCCTCTCCCACCTGG + Intergenic
948460141 2:238125232-238125254 ACGGGGGTCCCCCACTGACCAGG + Intronic
1175914384 20:62418950-62418972 ACTGAGCACCCACACCCACCTGG - Intronic
1176229480 20:64024690-64024712 ACAGGCAACCCTCACCCACCTGG - Exonic
1176387941 21:6148571-6148593 ACAGGGAACCCTCTCCCACCTGG + Intergenic
1179735531 21:43389677-43389699 ACAGGGAACCCTCTCCCACCTGG - Intergenic
1180000109 21:44991707-44991729 CCAGGGGACCCTCAGCGACGGGG - Intergenic
1181447103 22:22985669-22985691 ACTGGGGAGCCTCACAGCCTAGG - Intergenic
1182118930 22:27774503-27774525 ACTGGGAACCCCCACCCTCCTGG + Intronic
1183282986 22:36942776-36942798 ACTTGGGGCCCTCCCCAACCTGG + Intergenic
1183408720 22:37642734-37642756 CCTGGCCACCCTCACTGACCTGG - Intronic
1184792353 22:46707871-46707893 ACTGGGGACCAGCACAGCCCGGG + Exonic
952296893 3:32069939-32069961 AGTGGGGACCCACACAGACAGGG - Intronic
952404018 3:32989539-32989561 ACTGGGGACCCACATATACCGGG + Intergenic
952701658 3:36335333-36335355 ACAGGGGACCCTCCCCCACCTGG + Intergenic
952763457 3:36935222-36935244 ACTGTGGCCCCTCACCCTCCCGG - Intronic
954625827 3:52021425-52021447 ACTGGCCACCCTCAGAGACCGGG + Intergenic
960379157 3:116938938-116938960 ACTGGGGAACCTGACCATCCAGG + Intronic
962523945 3:136221246-136221268 AGTGGGGACCCACACAGACAGGG + Intergenic
967200970 3:187072220-187072242 ACAGGAGACCCTCACCGGGCTGG - Intronic
968504986 4:967442-967464 CCTGGCGCCCCTCACCCACCTGG - Intronic
968522867 4:1042099-1042121 CCTGGGGGCCCCCACCCACCAGG + Intergenic
968745897 4:2359934-2359956 CCTGGGGACCCCCATCCACCTGG + Intronic
968901944 4:3436098-3436120 GCTGGGGACCCACACGGACAGGG + Intronic
973205681 4:47557870-47557892 ACTGGGGGCTCTCACACACCTGG - Exonic
978267259 4:106841302-106841324 TCTGGAGACCTTCACCTACCTGG + Intergenic
982845607 4:160247753-160247775 ACTGGGGACCCTGAAAGACCAGG - Intergenic
993011493 5:82488433-82488455 ACTGGAGACCCTCCCCTACATGG - Intergenic
1001922207 5:175609564-175609586 ACTGTGCAGCCTCACGGACCAGG - Intergenic
1002445083 5:179285689-179285711 ACTGGGGACGTTCCCCGACGTGG - Intronic
1006192039 6:32215362-32215384 ACAGGGGAACCTCACAGAGCTGG + Exonic
1007274022 6:40660485-40660507 ACTGGAGACCCTCAGAGACCTGG - Intergenic
1017375026 6:153759433-153759455 ACTGGGGACCCTGAAAGTCCAGG + Intergenic
1018919480 6:168161431-168161453 AGTGGGGCTCCTCACAGACCAGG - Intergenic
1022315513 7:29241493-29241515 TCTGGGGACCCTCTCCCGCCTGG + Intronic
1023718742 7:43071755-43071777 TCTGGGGACCCCCTCCCACCTGG + Intergenic
1029104989 7:98167770-98167792 CCTGGGGGCGCTCCCCGACCAGG - Intronic
1029465232 7:100720947-100720969 GCCGGGGTCCCTCAGCGACCTGG - Exonic
1032230489 7:130070057-130070079 CCTGGGTCCCCTCACCTACCCGG + Intergenic
1037710099 8:21348594-21348616 ACTGGGGGGCCTAACCCACCTGG + Intergenic
1038433017 8:27515002-27515024 TCTGGGGACCCCCTCCCACCTGG - Intronic
1039588669 8:38728650-38728672 TCTGGGGACCCTCGCCGAAGAGG + Intronic
1046068554 8:109223487-109223509 TCTGGGGACCCCCTCCCACCTGG - Intergenic
1047793214 8:128226745-128226767 ACTGGGGAGAATCACCGACGTGG - Intergenic
1047904655 8:129460071-129460093 ACTGGGGCCCCTCACCCAGCTGG + Intergenic
1052616647 9:30851139-30851161 TCTGGGGACCCTCTCCCACCTGG - Intergenic
1053121192 9:35548378-35548400 AGTGGGGTCCCTGACAGACCTGG - Exonic
1053594211 9:39543678-39543700 ACTGGGGACCCTCTCCCACCTGG - Intergenic
1053851991 9:42298724-42298746 ACTGGGGACCCTCTCCCACCTGG - Intergenic
1054572042 9:66821279-66821301 ACTGGGGACCCTCTCCCACCTGG + Intergenic
1057721082 9:97532338-97532360 GCTGGGGAACCTCCTCGACCTGG + Intronic
1058512201 9:105731478-105731500 GGTGGGGAACCTCACAGACCAGG - Intronic
1061904440 9:133689407-133689429 ATTGGTGACCCTCCCCCACCAGG - Intronic
1190151750 X:47955515-47955537 ACTGGGGCCCCTCCCCGACAAGG + Intronic
1190160946 X:48030920-48030942 ACTGGGGCCCCTCCCCGACAAGG - Intronic
1190411747 X:50143482-50143504 TCTGGTGACCCTCACTGATCTGG + Intergenic
1199229676 X:145422880-145422902 ACTGGGGACCCTGAAAGTCCAGG + Intergenic
1199234279 X:145472429-145472451 TCCGGGGACCCTCTCCCACCTGG - Intergenic
1200102102 X:153693310-153693332 CCTGGGGGCCCTCACAGCCCTGG + Exonic