ID: 1132551325

View in Genome Browser
Species Human (GRCh38)
Location 16:554979-555001
Sequence CGGCAGGAGCAGATGGAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132551320_1132551325 -10 Left 1132551320 16:554966-554988 CCCATCAGTCACCCGGCAGGAGC No data
Right 1132551325 16:554979-555001 CGGCAGGAGCAGATGGAGTGAGG No data
1132551317_1132551325 13 Left 1132551317 16:554943-554965 CCGCACGGGGGGCTCTGTCTGAA No data
Right 1132551325 16:554979-555001 CGGCAGGAGCAGATGGAGTGAGG No data
1132551314_1132551325 25 Left 1132551314 16:554931-554953 CCAGCGAGGCATCCGCACGGGGG No data
Right 1132551325 16:554979-555001 CGGCAGGAGCAGATGGAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132551325 Original CRISPR CGGCAGGAGCAGATGGAGTG AGG Intergenic
No off target data available for this crispr