ID: 1132552811

View in Genome Browser
Species Human (GRCh38)
Location 16:560357-560379
Sequence GCGCGCGTGCGCCTGGGCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 155}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132552811_1132552823 18 Left 1132552811 16:560357-560379 CCGGAGCCCAGGCGCACGCGCGC 0: 1
1: 0
2: 1
3: 20
4: 155
Right 1132552823 16:560398-560420 TCGGGAGGTGCGAGCGGCGTCGG 0: 1
1: 0
2: 1
3: 3
4: 70
1132552811_1132552825 20 Left 1132552811 16:560357-560379 CCGGAGCCCAGGCGCACGCGCGC 0: 1
1: 0
2: 1
3: 20
4: 155
Right 1132552825 16:560400-560422 GGGAGGTGCGAGCGGCGTCGGGG 0: 1
1: 0
2: 0
3: 12
4: 139
1132552811_1132552819 3 Left 1132552811 16:560357-560379 CCGGAGCCCAGGCGCACGCGCGC 0: 1
1: 0
2: 1
3: 20
4: 155
Right 1132552819 16:560383-560405 CCTCTGCCGCCAACTTCGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 67
1132552811_1132552822 12 Left 1132552811 16:560357-560379 CCGGAGCCCAGGCGCACGCGCGC 0: 1
1: 0
2: 1
3: 20
4: 155
Right 1132552822 16:560392-560414 CCAACTTCGGGAGGTGCGAGCGG 0: 1
1: 0
2: 0
3: 3
4: 55
1132552811_1132552829 29 Left 1132552811 16:560357-560379 CCGGAGCCCAGGCGCACGCGCGC 0: 1
1: 0
2: 1
3: 20
4: 155
Right 1132552829 16:560409-560431 GAGCGGCGTCGGGGGGACGCGGG 0: 1
1: 0
2: 0
3: 15
4: 144
1132552811_1132552815 -1 Left 1132552811 16:560357-560379 CCGGAGCCCAGGCGCACGCGCGC 0: 1
1: 0
2: 1
3: 20
4: 155
Right 1132552815 16:560379-560401 CCCGCCTCTGCCGCCAACTTCGG 0: 1
1: 0
2: 0
3: 11
4: 162
1132552811_1132552828 28 Left 1132552811 16:560357-560379 CCGGAGCCCAGGCGCACGCGCGC 0: 1
1: 0
2: 1
3: 20
4: 155
Right 1132552828 16:560408-560430 CGAGCGGCGTCGGGGGGACGCGG 0: 1
1: 0
2: 0
3: 6
4: 155
1132552811_1132552826 21 Left 1132552811 16:560357-560379 CCGGAGCCCAGGCGCACGCGCGC 0: 1
1: 0
2: 1
3: 20
4: 155
Right 1132552826 16:560401-560423 GGAGGTGCGAGCGGCGTCGGGGG 0: 1
1: 0
2: 1
3: 23
4: 260
1132552811_1132552824 19 Left 1132552811 16:560357-560379 CCGGAGCCCAGGCGCACGCGCGC 0: 1
1: 0
2: 1
3: 20
4: 155
Right 1132552824 16:560399-560421 CGGGAGGTGCGAGCGGCGTCGGG 0: 1
1: 0
2: 1
3: 9
4: 83
1132552811_1132552817 0 Left 1132552811 16:560357-560379 CCGGAGCCCAGGCGCACGCGCGC 0: 1
1: 0
2: 1
3: 20
4: 155
Right 1132552817 16:560380-560402 CCGCCTCTGCCGCCAACTTCGGG 0: 1
1: 0
2: 0
3: 11
4: 177
1132552811_1132552827 22 Left 1132552811 16:560357-560379 CCGGAGCCCAGGCGCACGCGCGC 0: 1
1: 0
2: 1
3: 20
4: 155
Right 1132552827 16:560402-560424 GAGGTGCGAGCGGCGTCGGGGGG 0: 1
1: 0
2: 1
3: 14
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132552811 Original CRISPR GCGCGCGTGCGCCTGGGCTC CGG (reversed) Intergenic