ID: 1132552811

View in Genome Browser
Species Human (GRCh38)
Location 16:560357-560379
Sequence GCGCGCGTGCGCCTGGGCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 155}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132552811_1132552817 0 Left 1132552811 16:560357-560379 CCGGAGCCCAGGCGCACGCGCGC 0: 1
1: 0
2: 1
3: 20
4: 155
Right 1132552817 16:560380-560402 CCGCCTCTGCCGCCAACTTCGGG 0: 1
1: 0
2: 0
3: 11
4: 177
1132552811_1132552828 28 Left 1132552811 16:560357-560379 CCGGAGCCCAGGCGCACGCGCGC 0: 1
1: 0
2: 1
3: 20
4: 155
Right 1132552828 16:560408-560430 CGAGCGGCGTCGGGGGGACGCGG 0: 1
1: 0
2: 0
3: 6
4: 155
1132552811_1132552829 29 Left 1132552811 16:560357-560379 CCGGAGCCCAGGCGCACGCGCGC 0: 1
1: 0
2: 1
3: 20
4: 155
Right 1132552829 16:560409-560431 GAGCGGCGTCGGGGGGACGCGGG 0: 1
1: 0
2: 0
3: 15
4: 144
1132552811_1132552815 -1 Left 1132552811 16:560357-560379 CCGGAGCCCAGGCGCACGCGCGC 0: 1
1: 0
2: 1
3: 20
4: 155
Right 1132552815 16:560379-560401 CCCGCCTCTGCCGCCAACTTCGG 0: 1
1: 0
2: 0
3: 11
4: 162
1132552811_1132552822 12 Left 1132552811 16:560357-560379 CCGGAGCCCAGGCGCACGCGCGC 0: 1
1: 0
2: 1
3: 20
4: 155
Right 1132552822 16:560392-560414 CCAACTTCGGGAGGTGCGAGCGG 0: 1
1: 0
2: 0
3: 3
4: 55
1132552811_1132552827 22 Left 1132552811 16:560357-560379 CCGGAGCCCAGGCGCACGCGCGC 0: 1
1: 0
2: 1
3: 20
4: 155
Right 1132552827 16:560402-560424 GAGGTGCGAGCGGCGTCGGGGGG 0: 1
1: 0
2: 1
3: 14
4: 136
1132552811_1132552823 18 Left 1132552811 16:560357-560379 CCGGAGCCCAGGCGCACGCGCGC 0: 1
1: 0
2: 1
3: 20
4: 155
Right 1132552823 16:560398-560420 TCGGGAGGTGCGAGCGGCGTCGG 0: 1
1: 0
2: 1
3: 3
4: 70
1132552811_1132552824 19 Left 1132552811 16:560357-560379 CCGGAGCCCAGGCGCACGCGCGC 0: 1
1: 0
2: 1
3: 20
4: 155
Right 1132552824 16:560399-560421 CGGGAGGTGCGAGCGGCGTCGGG 0: 1
1: 0
2: 1
3: 9
4: 83
1132552811_1132552826 21 Left 1132552811 16:560357-560379 CCGGAGCCCAGGCGCACGCGCGC 0: 1
1: 0
2: 1
3: 20
4: 155
Right 1132552826 16:560401-560423 GGAGGTGCGAGCGGCGTCGGGGG 0: 1
1: 0
2: 1
3: 23
4: 260
1132552811_1132552825 20 Left 1132552811 16:560357-560379 CCGGAGCCCAGGCGCACGCGCGC 0: 1
1: 0
2: 1
3: 20
4: 155
Right 1132552825 16:560400-560422 GGGAGGTGCGAGCGGCGTCGGGG 0: 1
1: 0
2: 0
3: 12
4: 139
1132552811_1132552819 3 Left 1132552811 16:560357-560379 CCGGAGCCCAGGCGCACGCGCGC 0: 1
1: 0
2: 1
3: 20
4: 155
Right 1132552819 16:560383-560405 CCTCTGCCGCCAACTTCGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132552811 Original CRISPR GCGCGCGTGCGCCTGGGCTC CGG (reversed) Intergenic
900208348 1:1441048-1441070 GCCCGCGTGGCCCTGGGCCCAGG - Exonic
900291747 1:1926597-1926619 GCGTGGGTGTGCCTGGGCACCGG + Intronic
901483136 1:9539755-9539777 GGGCGCGCGCGGCTGGGCCCGGG - Intronic
901588377 1:10317545-10317567 GAGCCAGTGCGCCTGGCCTCAGG - Intronic
903374326 1:22856297-22856319 CCCCGCCTGCCCCTGGGCTCTGG - Intronic
903389480 1:22953857-22953879 GTGCGCGCGCGCCTGGCCGCGGG - Exonic
904715508 1:32464980-32465002 TCGCGGGAGCGCCTGGCCTCGGG - Intergenic
906144208 1:43550360-43550382 GGGCGAGTGCGCCTGGGGGCGGG - Intronic
906318851 1:44804560-44804582 TCGTGAGTGCTCCTGGGCTCAGG + Intronic
906521048 1:46467041-46467063 GCGCGCGTGCGCCCGTGGGCTGG - Intergenic
908501103 1:64744889-64744911 GCGCGGGCGCGCCTGTGCGCCGG + Intergenic
909629703 1:77759234-77759256 GCGCGCCGGCTCCTGGGTTCTGG - Intronic
914196601 1:145451091-145451113 GCGTGAGTGCGTCTGGGCTGTGG - Intergenic
914990713 1:152497505-152497527 GCGAGCCTGAGTCTGGGCTCTGG + Intergenic
918332503 1:183472910-183472932 GCGCGCGCGCCCTTGGTCTCGGG + Intronic
922648717 1:227318505-227318527 GCGCGCGTGTGCCGGGGCCGGGG - Intergenic
922937763 1:229434414-229434436 GCATGTGTGCGCCTGCGCTCCGG + Intergenic
923502676 1:234578972-234578994 GCCCACGTGCTCCTGGGCCCTGG - Intergenic
924801522 1:247332019-247332041 GCGCGCCTGGGCCTGGCCGCCGG + Intergenic
1066022876 10:31319942-31319964 GCGCGCGTGTGCGCGGGCGCCGG + Intronic
1070570664 10:77637777-77637799 GCGGGGAGGCGCCTGGGCTCGGG + Intronic
1070570884 10:77638533-77638555 GCGCTGGCTCGCCTGGGCTCCGG + Intronic
1072782109 10:98258139-98258161 CCGAGGGTGCGCCTGCGCTCCGG - Exonic
1075100486 10:119502921-119502943 GCCCTCGTGCGCCTGGGCTGTGG + Intronic
1075106628 10:119543441-119543463 CCGCGCGGGCGCCAGGACTCGGG + Intergenic
1076813081 10:132899207-132899229 GCGAGCGTGTGGCTGGGCCCTGG - Intronic
1076828853 10:132984125-132984147 GCGCGTGACCGCGTGGGCTCAGG + Intergenic
1077008268 11:369258-369280 GCGCGCGTCCACCTGGGCCACGG - Intergenic
1077065538 11:639563-639585 GCGCGGGGGCGCCGGGGCGCGGG - Intronic
1077074940 11:696052-696074 GCGCGCGGGCGCCTGGCCCCGGG + Intronic
1078233221 11:9461152-9461174 GCCCGCTTGGGCCCGGGCTCCGG + Intronic
1082986053 11:59172232-59172254 GCTCGCGGCCGCCGGGGCTCGGG + Intronic
1096707991 12:53434810-53434832 AGGCGCGTGCCACTGGGCTCAGG - Intergenic
1096788432 12:54030944-54030966 GGGGCCGGGCGCCTGGGCTCCGG - Intronic
1101466773 12:104957878-104957900 AGGCGCGGGGGCCTGGGCTCGGG + Intronic
1101680009 12:106955784-106955806 GCGCGCGTGCGCGTCGGAACTGG + Exonic
1102651966 12:114448538-114448560 GTGCGCGCGCGCCAGGGCTTAGG - Intergenic
1103480613 12:121247835-121247857 GCCGGCGGGCCCCTGGGCTCTGG - Intronic
1103690999 12:122774483-122774505 GCGTGCGCCCGCCGGGGCTCGGG - Exonic
1105014762 12:132779720-132779742 GCACGTGTGTGCCTGGGCTGTGG - Intronic
1105681877 13:22736518-22736540 GAGCGCGAGCTCCTGGCCTCCGG - Intergenic
1105767814 13:23578960-23578982 GCGCTGCTGCGCCTGAGCTCAGG - Intronic
1112208202 13:97346744-97346766 CCGCAGGGGCGCCTGGGCTCAGG + Intronic
1112509430 13:99997070-99997092 GCGCGCGCGCCCCTGGGCGCAGG + Intergenic
1113432849 13:110265504-110265526 CAGCGCGTGAGCCTGGGATCAGG + Intronic
1117315357 14:54566841-54566863 GCGCGGGGGAGCCGGGGCTCTGG + Intergenic
1119438021 14:74610876-74610898 GCGGGCGTGGGCGTGAGCTCTGG - Intronic
1127142751 15:55993805-55993827 GAGGGCGTGCGGCGGGGCTCGGG + Intergenic
1127433423 15:58933754-58933776 CCGCGCGTGCGCGTTGGCGCAGG + Intronic
1130926729 15:88391125-88391147 GCGCGGGAGCTCCTGGGCCCGGG + Intergenic
1132320172 15:100919561-100919583 GCCCGCGGGCCCCTGCGCTCCGG + Intronic
1132398327 15:101489851-101489873 GCGCTCCTGCGACCGGGCTCCGG + Intronic
1132552811 16:560357-560379 GCGCGCGTGCGCCTGGGCTCCGG - Intergenic
1132585842 16:705484-705506 GTGCGCGTGCGGCCGGGCTGCGG - Intronic
1132907341 16:2289523-2289545 GCGCGCCAGCGACTGGGCTGTGG - Exonic
1134509276 16:14833706-14833728 GCGCGCGTGCGCGGCGGCTCTGG + Exonic
1134974861 16:18562164-18562186 GCGCGCGTGCGCGGCGGCTCTGG - Intronic
1135342928 16:21664240-21664262 GCGCGCGGGGGCCTGGGCGGAGG + Intergenic
1136579367 16:31142523-31142545 GAGCGCGTGCGGCGGGTCTCCGG + Exonic
1136627799 16:31472457-31472479 GCCCGCGGGCGCCCGGGCGCGGG + Intronic
1136637891 16:31537467-31537489 GCCCGGCTGCTCCTGGGCTCTGG - Intergenic
1138179254 16:54931106-54931128 GCGGGCGGGCACCTGGCCTCTGG - Exonic
1138327992 16:56191420-56191442 GCGCGCGCGCGCCTGGGCCCGGG - Intronic
1138956860 16:61981682-61981704 GCGCGCGCGCGCGTGCGCTTGGG + Intronic
1142177049 16:88650236-88650258 GCACGGGTGAGGCTGGGCTCAGG - Intronic
1143016369 17:3893057-3893079 GCCCGCGGGCGCCGCGGCTCCGG + Intronic
1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG + Intronic
1143155370 17:4833254-4833276 GCTCGCCTGCGCCTGCGCGCAGG + Intergenic
1143949031 17:10618418-10618440 GCTCCCGTGCTCCTGTGCTCTGG - Intergenic
1145291608 17:21551226-21551248 GCGCGGGCTCGCCGGGGCTCGGG + Exonic
1147317547 17:39627956-39627978 CCGCGTGTGTGCCTGGGCTGGGG + Intronic
1148419053 17:47531032-47531054 GCGCGCGCACGCCTGGGCAGAGG - Intronic
1149712672 17:58756706-58756728 GCGGGAGGGCGCCGGGGCTCAGG - Intronic
1151749424 17:76028187-76028209 GCGCCAGTAAGCCTGGGCTCTGG + Intergenic
1151805135 17:76400386-76400408 GCACGCGTGGGACAGGGCTCTGG - Intronic
1152426452 17:80220845-80220867 GCGCGCGGGCGCCGGGGCCCTGG + Intronic
1152660734 17:81540792-81540814 GCGGGCCTGCCCCTGGGCTCTGG - Exonic
1152828307 17:82481223-82481245 GCGGGGGTGCACCTGGGCGCTGG + Intronic
1153411866 18:4802679-4802701 GGGTGAGTGCTCCTGGGCTCCGG + Intergenic
1156488985 18:37485388-37485410 GCGCGCGGGCTCCCGAGCTCAGG + Intronic
1160053239 18:75455899-75455921 GCGAGCGCGGGGCTGGGCTCTGG + Intergenic
1161518926 19:4712933-4712955 GCACACGCGGGCCTGGGCTCAGG + Intronic
1162954360 19:14090209-14090231 GCGCGCGTGCGCTCCGGCTCCGG + Exonic
1165327836 19:35124617-35124639 TTGCGCGTGCGCCGGGGCACAGG - Exonic
1166088091 19:40490069-40490091 CCGCGCGTGGGCCTGGGCTAGGG - Exonic
1166961040 19:46495919-46495941 TCGCGCGTGCGCCTGCGCAGAGG + Exonic
1167134529 19:47608989-47609011 GGGCGCGCGGGCCTGGGCGCGGG + Intronic
1168011638 19:53538090-53538112 GTGCGCGTGCGCATGCGCGCTGG + Intronic
1168317578 19:55490771-55490793 GAGCGGCTGCGCCTGGTCTCTGG + Exonic
1168721037 19:58555162-58555184 GCGCGCGTGCGCCCGTGCCCCGG + Intergenic
926104700 2:10142800-10142822 GCCCGCGGGCACCTGGGCTCAGG - Intronic
926626634 2:15095985-15096007 GGGAGCTTGCGCCTGGGCTGGGG - Intergenic
929313570 2:40452149-40452171 GCGCGCGCGCGCCCGGGCCCCGG - Intronic
929974126 2:46616051-46616073 GCGCGCGCGCGCGTGGGCGGAGG + Intronic
931649372 2:64454392-64454414 GCGCGCGCGCGCCCGGGGCCCGG - Exonic
933437203 2:82263017-82263039 GGGTGAGTGCCCCTGGGCTCTGG + Intergenic
933893295 2:86789902-86789924 GCGCGCGGACCCCTGTGCTCGGG + Intronic
935547640 2:104417653-104417675 GCGTGGGTGGGCCTGGGCTGAGG + Intergenic
938549910 2:132370562-132370584 GGGCGAGTGCCCCTGGGCTCTGG + Intergenic
938919909 2:135985654-135985676 GCGCGCGGCCGCCAGCGCTCCGG - Exonic
946101006 2:217323079-217323101 GCTCTCGAACGCCTGGGCTCAGG + Intronic
947518830 2:230828748-230828770 GTGGGCGGGCGCCTGCGCTCAGG - Intergenic
948046613 2:234951007-234951029 CCGCGCTTTCTCCTGGGCTCCGG + Intergenic
949017203 2:241720214-241720236 GCCCGCCTGCCCCTGGGCTCTGG + Intronic
1172169468 20:32920287-32920309 GGGCTCGGGGGCCTGGGCTCGGG + Intronic
1172587212 20:36093086-36093108 GCGCGCGTGCGTGTGTGCGCCGG + Intronic
1172666751 20:36605650-36605672 GCGCGCTTGCGCCAAGGCGCCGG + Intronic
1175107767 20:56626972-56626994 GCGCGCGCGTGCCTGGGTGCCGG + Intergenic
1175824133 20:61927545-61927567 GCGATCATGCGTCTGGGCTCAGG + Intronic
1175841311 20:62029463-62029485 GCGCGCGCGCACGTGGGCACTGG - Intronic
1176015545 20:62929359-62929381 GCGCGCCTGGGCCTCGGCGCTGG + Intronic
1176555787 21:8253491-8253513 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176574724 21:8436525-8436547 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176611338 21:8987818-8987840 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1180675082 22:17581239-17581261 GCGCGCGTGAGCCTGGGGGCTGG + Intronic
1180951705 22:19723421-19723443 GCGCGCGTCCGCGCGGCCTCTGG + Exonic
1182586298 22:31346016-31346038 GCGCGCGCGCGCCTGCGCGGCGG - Exonic
1183207900 22:36432271-36432293 GGGGGTGTGCGCCGGGGCTCAGG - Intergenic
1184164696 22:42720538-42720560 GCCCGCGAGGGCCGGGGCTCCGG + Intronic
1184523229 22:45007793-45007815 GCGCGCGGCCGGCCGGGCTCTGG + Intronic
1203252772 22_KI270733v1_random:125576-125598 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203260828 22_KI270733v1_random:170662-170684 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
954151836 3:48661802-48661824 GAGCGCATGCGCTTGGGCGCCGG + Exonic
954627596 3:52030967-52030989 GCGTGCCTGGGCCTGGTCTCTGG - Intergenic
956080247 3:65549450-65549472 CCGAGCGCGCGCCTGGGCTCCGG - Intronic
960359751 3:116697357-116697379 GGGCGAGTGCCCCTGGGTTCTGG + Intronic
961604106 3:128081165-128081187 GGGCGCTTGCCCCTGGGCTTGGG - Exonic
963335713 3:143971974-143971996 GTGCGCGTGCGCGCGGGCACGGG + Exonic
966866127 3:184260047-184260069 GCCCGCGGGCGCCTGGGCCGGGG + Exonic
969597681 4:8158330-8158352 CCGCGCGGGGGCCTGGGGTCCGG - Intronic
973551302 4:52038325-52038347 GCGCGCCTGCGCTTGCGCCCTGG + Exonic
974036377 4:56821722-56821744 GCGCTCGTGCGACGGGGCGCGGG + Exonic
974987174 4:69042270-69042292 GGGCGAGCGCCCCTGGGCTCTGG - Intronic
976704520 4:88007429-88007451 GGGCGCCCGCGCCCGGGCTCCGG + Intergenic
977574090 4:98658739-98658761 GCGCGCGCGCGCACGGGGTCGGG + Intergenic
982224483 4:153153368-153153390 GCGCGCGTGCGGCGGGGCTGCGG + Intronic
987504787 5:18754070-18754092 GGGCAAGTGCCCCTGGGCTCTGG + Intergenic
993501811 5:88674429-88674451 GCGCGCGTGCGACCGGGTACGGG + Intergenic
995494429 5:112726085-112726107 GGGCAAGTGCCCCTGGGCTCCGG + Intronic
996669498 5:126100696-126100718 GGGCGAGTGCCCCTGGACTCCGG + Intergenic
998517707 5:142770714-142770736 GCGCGCCTCCGCCGGGGCCCGGG - Exonic
998868574 5:146530107-146530129 GAGTGAGTGCCCCTGGGCTCTGG - Intergenic
1001773418 5:174312027-174312049 GCGCGGGGGCGCGGGGGCTCGGG + Intergenic
1003645417 6:7910254-7910276 GGGCGCGGGCGCCGCGGCTCGGG - Intronic
1006337528 6:33428198-33428220 GCGCGCGTGTGCGTGGGCGCGGG + Intronic
1011556255 6:88573830-88573852 GTGCGCCTGTGCCTGGGCTTGGG + Intergenic
1014535657 6:122610488-122610510 GAGCGCGAGCGCCAGGGCACCGG + Intronic
1018091132 6:160347908-160347930 GCGCGCGCGCGCCCCGGGTCCGG - Intergenic
1022133305 7:27424004-27424026 GCGCGCGTGCGCGTGCACTTGGG - Intergenic
1023791910 7:43759097-43759119 GAGCGCGAGCGGCTGGGCCCGGG + Intronic
1025262193 7:57426706-57426728 GCGGGAGTGGGCCTGGGCACAGG - Intergenic
1032077270 7:128842073-128842095 GAGCACGTGGCCCTGGGCTCTGG + Intronic
1033237432 7:139649319-139649341 GCGGGTGTGCACCGGGGCTCTGG - Intronic
1035747551 8:1973489-1973511 CCGCGCGTGGGCGCGGGCTCGGG + Intergenic
1037446541 8:18971371-18971393 CCTCCCATGCGCCTGGGCTCTGG + Intronic
1039721761 8:40172357-40172379 GCCTGCATGAGCCTGGGCTCTGG + Intergenic
1043471322 8:80566028-80566050 GCCCCCGCGCGCCTGGGGTCTGG - Intergenic
1044666709 8:94640344-94640366 ACGAGCGTGCACCCGGGCTCCGG + Intergenic
1047423563 8:124727075-124727097 GCGCGCGCGCGCGTGGGGGCGGG - Intronic
1049762562 8:144337788-144337810 GCGCGGGGGCTCCGGGGCTCCGG + Intergenic
1050041900 9:1504395-1504417 GAGCAAGTGCTCCTGGGCTCTGG - Intergenic
1051263526 9:15288796-15288818 GGGCAAGTGCCCCTGGGCTCCGG - Intronic
1054333332 9:63781653-63781675 CCGCGCCTGCGCCGGCGCTCTGG - Intergenic
1055486329 9:76759864-76759886 GGGCGAGTGCTTCTGGGCTCCGG - Intronic
1057208205 9:93185416-93185438 CGGCGAGTGCGCCCGGGCTCAGG - Exonic
1057225293 9:93289665-93289687 CCGGGCCTGCGCCCGGGCTCCGG - Intronic
1061506224 9:131033397-131033419 GAGAGCGTGTGCCTGGGGTCGGG + Intronic
1062474584 9:136720737-136720759 GAGCGCTTGAGCCTGGGCACTGG + Intronic
1062653590 9:137590627-137590649 GGGCGAGTGCGCCGGCGCTCTGG + Intergenic
1062656377 9:137606093-137606115 GCCTGCGTGCGCCCGCGCTCAGG - Intronic
1062698131 9:137885743-137885765 GCGTGAGTGCGTCTGGGCTGTGG + Intronic
1203469175 Un_GL000220v1:108727-108749 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203476996 Un_GL000220v1:152699-152721 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1185621836 X:1454404-1454426 GAGCAGGTGCGGCTGGGCTCTGG - Intergenic
1190984785 X:55490290-55490312 GCAAGCATGTGCCTGGGCTCAGG - Intergenic
1195625178 X:106999816-106999838 GCGCGCGGGCCCCTGGGCTGCGG - Intronic
1200155532 X:153972739-153972761 GCGCCGGTGCGCCTGCGCGCAGG - Exonic