ID: 1132553923

View in Genome Browser
Species Human (GRCh38)
Location 16:564533-564555
Sequence GACCCCGAGGACCCCCGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 115}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132553923_1132553933 13 Left 1132553923 16:564533-564555 CCAGCGCGGGGGTCCTCGGGGTC 0: 1
1: 0
2: 1
3: 8
4: 115
Right 1132553933 16:564569-564591 AGGCTCTAGGCTGGGGCCACAGG 0: 1
1: 0
2: 5
3: 35
4: 354
1132553923_1132553935 20 Left 1132553923 16:564533-564555 CCAGCGCGGGGGTCCTCGGGGTC 0: 1
1: 0
2: 1
3: 8
4: 115
Right 1132553935 16:564576-564598 AGGCTGGGGCCACAGGGCAGAGG 0: 1
1: 0
2: 16
3: 113
4: 948
1132553923_1132553936 28 Left 1132553923 16:564533-564555 CCAGCGCGGGGGTCCTCGGGGTC 0: 1
1: 0
2: 1
3: 8
4: 115
Right 1132553936 16:564584-564606 GCCACAGGGCAGAGGCCGTGAGG 0: 1
1: 0
2: 0
3: 35
4: 378
1132553923_1132553926 -7 Left 1132553923 16:564533-564555 CCAGCGCGGGGGTCCTCGGGGTC 0: 1
1: 0
2: 1
3: 8
4: 115
Right 1132553926 16:564549-564571 CGGGGTCTCCAGGAGAGCCTAGG 0: 1
1: 0
2: 1
3: 23
4: 252
1132553923_1132553938 29 Left 1132553923 16:564533-564555 CCAGCGCGGGGGTCCTCGGGGTC 0: 1
1: 0
2: 1
3: 8
4: 115
Right 1132553938 16:564585-564607 CCACAGGGCAGAGGCCGTGAGGG 0: 1
1: 0
2: 3
3: 25
4: 290
1132553923_1132553929 4 Left 1132553923 16:564533-564555 CCAGCGCGGGGGTCCTCGGGGTC 0: 1
1: 0
2: 1
3: 8
4: 115
Right 1132553929 16:564560-564582 GGAGAGCCTAGGCTCTAGGCTGG 0: 1
1: 0
2: 2
3: 10
4: 166
1132553923_1132553927 0 Left 1132553923 16:564533-564555 CCAGCGCGGGGGTCCTCGGGGTC 0: 1
1: 0
2: 1
3: 8
4: 115
Right 1132553927 16:564556-564578 TCCAGGAGAGCCTAGGCTCTAGG 0: 1
1: 0
2: 3
3: 23
4: 190
1132553923_1132553930 5 Left 1132553923 16:564533-564555 CCAGCGCGGGGGTCCTCGGGGTC 0: 1
1: 0
2: 1
3: 8
4: 115
Right 1132553930 16:564561-564583 GAGAGCCTAGGCTCTAGGCTGGG 0: 1
1: 0
2: 0
3: 15
4: 164
1132553923_1132553934 14 Left 1132553923 16:564533-564555 CCAGCGCGGGGGTCCTCGGGGTC 0: 1
1: 0
2: 1
3: 8
4: 115
Right 1132553934 16:564570-564592 GGCTCTAGGCTGGGGCCACAGGG 0: 1
1: 0
2: 2
3: 35
4: 292
1132553923_1132553939 30 Left 1132553923 16:564533-564555 CCAGCGCGGGGGTCCTCGGGGTC 0: 1
1: 0
2: 1
3: 8
4: 115
Right 1132553939 16:564586-564608 CACAGGGCAGAGGCCGTGAGGGG 0: 1
1: 0
2: 3
3: 41
4: 454
1132553923_1132553931 6 Left 1132553923 16:564533-564555 CCAGCGCGGGGGTCCTCGGGGTC 0: 1
1: 0
2: 1
3: 8
4: 115
Right 1132553931 16:564562-564584 AGAGCCTAGGCTCTAGGCTGGGG 0: 1
1: 0
2: 1
3: 25
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132553923 Original CRISPR GACCCCGAGGACCCCCGCGC TGG (reversed) Intronic