ID: 1132555837

View in Genome Browser
Species Human (GRCh38)
Location 16:572286-572308
Sequence CAGTGGTCAGAGAGGGCAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 622
Summary {0: 1, 1: 2, 2: 5, 3: 50, 4: 564}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132555837_1132555845 -4 Left 1132555837 16:572286-572308 CCGCCTGCCCTCTCTGACCACTG 0: 1
1: 2
2: 5
3: 50
4: 564
Right 1132555845 16:572305-572327 ACTGAGGAAATGGGCATTTGAGG 0: 1
1: 0
2: 2
3: 36
4: 261
1132555837_1132555846 20 Left 1132555837 16:572286-572308 CCGCCTGCCCTCTCTGACCACTG 0: 1
1: 2
2: 5
3: 50
4: 564
Right 1132555846 16:572329-572351 GTTCTGCAGCCTGACCCAGAAGG 0: 1
1: 0
2: 2
3: 27
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132555837 Original CRISPR CAGTGGTCAGAGAGGGCAGG CGG (reversed) Intronic
900991546 1:6100468-6100490 CAATGGTGCCAGAGGGCAGGTGG + Exonic
901797829 1:11691095-11691117 AAGTGCGCAGAGTGGGCAGGCGG - Intronic
902264827 1:15255818-15255840 TAGAGGTCAGAGTGGGAAGGGGG + Intronic
902288725 1:15423113-15423135 CAGGGACCAGAGATGGCAGGAGG + Intronic
902727545 1:18347165-18347187 CTGTGTTCAGAGAGGGAGGGAGG - Intronic
903173928 1:21569662-21569684 CATTGCTAAGAGAAGGCAGGGGG + Intronic
903804497 1:25995217-25995239 CAGTGATCAGAGATGATAGGAGG - Intronic
904173012 1:28605222-28605244 CAAGGGTCAGAGAGGGCAAGAGG - Intronic
904214838 1:28911074-28911096 CAGAAGTCTGAGAGGGCAGATGG + Intronic
904677022 1:32205028-32205050 AGGGGGTGAGAGAGGGCAGGCGG + Intronic
904862547 1:33549697-33549719 CAGTGATAAGAAAGGGAAGGAGG + Intronic
906249647 1:44301295-44301317 CAGTGCACAGTGGGGGCAGGGGG - Intronic
906305993 1:44719552-44719574 CAGTGGTCTGGGAAGGCAGAGGG - Intronic
907257477 1:53190755-53190777 CAATGGTCAGGGAGGGCTTGGGG + Intergenic
907407107 1:54260395-54260417 CAGTGGTCAGGGAGGGCAGGAGG + Intronic
908690926 1:66779633-66779655 CAGAGGAGAGAGAGAGCAGGAGG - Intergenic
908792658 1:67798361-67798383 CAGTGGTCACAGAGGGGTTGGGG - Intronic
912543430 1:110433931-110433953 CTGTGGGCTGAGAGTGCAGGAGG - Intergenic
912551151 1:110486129-110486151 TAGTGGTCAGAGTAGGCTGGTGG + Intergenic
912704632 1:111902863-111902885 AAGTGTTCAGAATGGGCAGGGGG - Intronic
913490357 1:119374149-119374171 CATGGGGAAGAGAGGGCAGGGGG - Intronic
915106973 1:153540803-153540825 CAGCGGGCAGGGAGGGCAGGGGG + Intronic
915625496 1:157111789-157111811 GAGGGACCAGAGAGGGCAGGAGG + Intergenic
915638399 1:157202640-157202662 CTGAGCTCAGAGAGGCCAGGTGG - Intergenic
915658493 1:157381318-157381340 CTGAGCTCAGAGAGGCCAGGTGG - Intergenic
917719105 1:177769157-177769179 ATGAGGTCAGAGAGGTCAGGTGG - Intergenic
918081805 1:181213614-181213636 CTGTGGTCTGAGAGGGAAGAAGG + Intergenic
919793487 1:201307358-201307380 CCGTGCCCAGAGAGGTCAGGAGG + Intronic
921098851 1:211911149-211911171 AGGTGGTCAGGGAGGGGAGGAGG - Intergenic
921219533 1:212963326-212963348 CAGTGGCCCCAGTGGGCAGGGGG - Intronic
921308142 1:213817306-213817328 CAGAGGCCAGAGAAGGAAGGCGG + Intergenic
921349266 1:214218980-214219002 TAGTGGTCAAAGAAGGAAGGAGG - Intergenic
922061957 1:222101343-222101365 AAGTTCTCAGAGAGGGAAGGTGG - Intergenic
922185093 1:223267144-223267166 CAGTGGCCAGAAAGAGCAGCAGG + Intronic
922415563 1:225419227-225419249 CTGGGCCCAGAGAGGGCAGGTGG - Intronic
924140876 1:241021979-241022001 CAGTGATCAGAGAACCCAGGAGG - Intronic
924252445 1:242146046-242146068 CAGGGGTCAGAGATGGAAAGTGG + Intronic
924937839 1:248787385-248787407 CAGTGGCCAGGGATGGCAGTTGG - Intergenic
1062823337 10:550940-550962 CAGTGTCCAGTGAGGGCAGAGGG - Intronic
1062823354 10:551022-551044 CAGTGTCCAGTGAGGGCAGAGGG - Intronic
1062926383 10:1318577-1318599 CAGTGCCCAGAGAGATCAGGTGG - Intronic
1063060461 10:2545771-2545793 CACTGGCCAGAAAGGGGAGGAGG + Intergenic
1063337437 10:5229300-5229322 CATTGGTCTGAGGGGGGAGGTGG + Intergenic
1063391078 10:5650187-5650209 CAGTGCTCAGAGTAGGCTGGTGG - Intronic
1063916627 10:10889583-10889605 CATGGGTCAGAGACGGCTGGAGG - Intergenic
1064694210 10:17949502-17949524 CAGCAGTCAAAGAGGGCAGCAGG - Intergenic
1066218171 10:33309158-33309180 CAGTGTTCAGTGTGGGCAAGAGG - Intronic
1067143774 10:43678771-43678793 CAGTGAACACAGTGGGCAGGAGG - Intergenic
1067521512 10:47010619-47010641 CAGTGGGGAGAGAGGGAGGGAGG - Intergenic
1067540076 10:47144679-47144701 CAGTACTCAGGGATGGCAGGGGG + Intergenic
1067546015 10:47193172-47193194 CAGGGGAAACAGAGGGCAGGAGG + Intergenic
1067820082 10:49520764-49520786 CTGAGGACAGGGAGGGCAGGTGG - Intronic
1067928134 10:50531715-50531737 CAGTGGGCAGGTAGGGAAGGTGG - Intronic
1068659851 10:59612640-59612662 CAGAGGTAAGAGAGGGAAGGTGG - Intergenic
1068949404 10:62762090-62762112 CAGTGGTCAGTGAAGGCTTGTGG - Intergenic
1069040111 10:63687147-63687169 CAGTGGGCAGTGGGGGCGGGGGG - Intergenic
1070525173 10:77290020-77290042 CAGGGGTTAGAGATGGAAGGAGG + Intronic
1072066873 10:91879913-91879935 CAGTGGGCAGGGGGGGCATGGGG - Intergenic
1072169752 10:92848277-92848299 TAGTCGCGAGAGAGGGCAGGAGG + Intronic
1072249245 10:93568516-93568538 AAGTGGTCAGAGAGGGGAGTAGG + Intronic
1073156815 10:101354062-101354084 GAGAGGTAAGAGAGGGCGGGGGG + Exonic
1073420644 10:103421211-103421233 CTGTGTTCAGAGAGGGCTTGGGG + Intronic
1073426571 10:103458808-103458830 CAGTGGGCAGGGTGGGCAGCAGG - Exonic
1074603861 10:114941064-114941086 GAGTGGACAGAGAAGGGAGGAGG - Intronic
1075360354 10:121826760-121826782 GAGTGGGGAGAGAGGGAAGGTGG - Intronic
1075596846 10:123738081-123738103 CAGGAGAAAGAGAGGGCAGGGGG - Intronic
1076059152 10:127400060-127400082 CAGTGTCCAGGGAGGGTAGGAGG - Intronic
1076094525 10:127720493-127720515 CAGTGGACTGAGGGGGCACGTGG + Intergenic
1076182280 10:128419511-128419533 CAGTGGCCAAAGAGTGCAGTGGG - Intergenic
1076739733 10:132477360-132477382 CAGGGGCCAGAGCTGGCAGGAGG - Intergenic
1076795398 10:132795592-132795614 AGGGGGTCAGGGAGGGCAGGGGG + Intergenic
1077015952 11:399312-399334 CAGGTGGCAGAGGGGGCAGGTGG - Intronic
1077185774 11:1234750-1234772 CAGCGGGCAGGGAGGGCAGGGGG + Intronic
1077185783 11:1234766-1234788 CAGGGGGCGGGGAGGGCAGGGGG + Intronic
1077198490 11:1293401-1293423 GTGTGGGCAGAGAGGGGAGGAGG + Intronic
1077377408 11:2211496-2211518 CAGTGGGCAGAGAGAGCACACGG + Intergenic
1077458433 11:2695013-2695035 CAGTGGTCAGAGAGGTAAGCAGG + Intronic
1078706442 11:13748312-13748334 CAGTGGTTAAGGAGAGCAGGAGG - Intergenic
1079005462 11:16788753-16788775 CAGGGTTCAGAGAGGAGAGGAGG - Exonic
1079093196 11:17494834-17494856 CCGTGGACAGAGCTGGCAGGTGG - Intronic
1079621190 11:22556698-22556720 CAGTGGGTAGAGCAGGCAGGTGG + Intergenic
1080368964 11:31611856-31611878 AAGTGGGCAGAGAGGGCAGTGGG + Intronic
1080384274 11:31801476-31801498 CAGTGGAGAGAGAGGGTGGGAGG + Intronic
1080688716 11:34537725-34537747 CAGAGGTCACAGAGGGAAGACGG - Intergenic
1081771433 11:45652492-45652514 CAGAAGTCAGCAAGGGCAGGGGG + Intronic
1081806737 11:45895012-45895034 CAGTGCTCAGAGGGAGCACGTGG - Intronic
1081813278 11:45924897-45924919 CAGTGGTGAGGGGAGGCAGGCGG + Intronic
1082870005 11:57935570-57935592 ATGTGGTGAGAGAGAGCAGGAGG + Intergenic
1083687527 11:64385478-64385500 CACTGGACACAGAGGGGAGGTGG + Intergenic
1083727897 11:64637858-64637880 CTGTGCCCAGAGAGGGCGGGAGG + Intronic
1083735186 11:64676122-64676144 CAGCGGGCAGAGAGGGCAGGGGG + Intronic
1083791588 11:64989479-64989501 CAAGGGACAGTGAGGGCAGGGGG + Exonic
1083966418 11:66046589-66046611 CAGGAGTAAGAGAGGGGAGGAGG + Intronic
1083994854 11:66266850-66266872 CTGTGGGCAGAGGGGGCAGGTGG - Intronic
1084154934 11:67308097-67308119 CAGAGGTCCCAGAGGGAAGGTGG + Intronic
1084175074 11:67418733-67418755 CTGTGGGCAGAGAAGGCAAGTGG - Intronic
1084607563 11:70181311-70181333 CAGTCCCCACAGAGGGCAGGGGG + Intronic
1084733743 11:71091371-71091393 CTGTGGTCAGACTGGGCAGTGGG - Intronic
1084859518 11:72009186-72009208 CTGTGGGCAGAGAGGGTGGGTGG + Intronic
1084860689 11:72015987-72016009 CAGAGGTCAGAGAGGCCACCTGG + Exonic
1085238418 11:75032623-75032645 CAGTCCTCAGAGAGTGCAGAAGG + Intergenic
1085865282 11:80283403-80283425 CAGTGGGAAGAGGGAGCAGGAGG - Intergenic
1088903725 11:114138115-114138137 AAGTGGTGAGGGAGGGCAGGAGG + Intronic
1089317306 11:117600823-117600845 CAGTGGCCAGCCAGGGCAGAAGG - Intronic
1089796990 11:120988922-120988944 AAGGAGACAGAGAGGGCAGGTGG - Intergenic
1089847168 11:121467384-121467406 CAGTGATCAGAGTGGGCAAAAGG - Intronic
1090663123 11:128895698-128895720 CAGTGGTCTGAGAGCTCAGAGGG - Intronic
1090837160 11:130462050-130462072 AAGAGGACTGAGAGGGCAGGAGG - Intronic
1091217055 11:133908528-133908550 CTGTGGTCAGTGGAGGCAGGAGG - Intergenic
1091330377 11:134727295-134727317 CAGTGGTCAAAGAGCCAAGGGGG - Intergenic
1091357314 11:134947267-134947289 CAGTGGACAGAGTGGGAAGGTGG - Intergenic
1091668456 12:2435906-2435928 CAGTGGACAGACTGGCCAGGAGG + Intronic
1093498347 12:19782601-19782623 CAGTGCTTTGAGAGGGCAAGAGG + Intergenic
1093507262 12:19882623-19882645 GAGTGGTCAGAGAGCCAAGGAGG - Intergenic
1093669520 12:21856967-21856989 CAGTGCTGAGAGAGGGTAGATGG - Intronic
1095954022 12:47796329-47796351 CAGAGGCCAGGGTGGGCAGGAGG + Intronic
1096764081 12:53868774-53868796 CAGTGGTGGGAGATGGCAGCAGG + Intergenic
1097167529 12:57093696-57093718 TAGTCGTCAGAGAGGGCAGTAGG + Intronic
1097183383 12:57183672-57183694 CAGAGGTGAGAGAGTGCCGGAGG - Intronic
1097386986 12:58962014-58962036 GAGTGGGGAGAGAGGGCAGCAGG - Intergenic
1098569939 12:71976952-71976974 CAGTGGTTACAAGGGGCAGGAGG + Intronic
1098878189 12:75889041-75889063 TATTTGTCAGAGAGGGAAGGAGG - Intergenic
1099505470 12:83470901-83470923 CAGATGTCTGAGTGGGCAGGAGG - Intergenic
1100343922 12:93708596-93708618 GAGTGGTCAGAGAAGGCTGGTGG - Intronic
1101968153 12:109294767-109294789 CAGAGGTCAGTGTGGGCAGGGGG - Intronic
1102551250 12:113693769-113693791 CAGAGGTCAGACAGGGCTGATGG + Intergenic
1103721008 12:122975412-122975434 CAGTGGGCAGAGAGGGGTAGTGG + Intronic
1103785922 12:123432945-123432967 CAGGGGTCAGAGAAGGTATGAGG + Intronic
1103853937 12:123951602-123951624 AAGTGCACAGAGAGGGCAGCAGG - Intronic
1103881688 12:124171160-124171182 GAATGGTCAAAGAAGGCAGGTGG - Intronic
1103999146 12:124849326-124849348 CCGTGGGCAGAGAGGGGATGAGG - Intronic
1104586330 12:130050993-130051015 CAGGGGACAGAGAGGAGAGGTGG - Intergenic
1104903722 12:132202723-132202745 CAGTGGCCAGGGAAGGAAGGGGG + Intronic
1105070403 12:133231134-133231156 CAGTGGAGATGGAGGGCAGGTGG - Intronic
1105649994 13:22366632-22366654 CAGAGGTGGGAGAGGGTAGGGGG + Intergenic
1105843106 13:24272513-24272535 GAGAGCTCTGAGAGGGCAGGGGG + Intronic
1106907048 13:34420172-34420194 CAGTGGTCAGTGAGGGTTGTTGG - Intergenic
1107361426 13:39621758-39621780 CTGTGGTCTGAGAGGGTAGTTGG - Intergenic
1107420328 13:40240107-40240129 CAGTGTGGAGGGAGGGCAGGGGG - Intergenic
1107697621 13:43015850-43015872 CAGTGGAAGGAGAGGGGAGGAGG - Intergenic
1107958968 13:45542554-45542576 CTGTGGGCAGAGAGACCAGGGGG - Intronic
1110121633 13:71888806-71888828 CAGTTGGCAGAGAGGGAATGTGG + Intergenic
1113578972 13:111414585-111414607 CCACGGTCAGAGGGGGCAGGTGG - Intergenic
1113606278 13:111609846-111609868 CACTGGGCACAGAGGGCAGCAGG - Intronic
1114756889 14:25269616-25269638 CAGCCGACAGAGTGGGCAGGTGG - Intergenic
1116426814 14:44800440-44800462 GAGTGGGGAGAGAGGGAAGGGGG + Intergenic
1116730113 14:48610784-48610806 GAGTGGTGAGAGAGGGCATCTGG - Intergenic
1117374467 14:55108109-55108131 CAGTGGTCAGCGTGGGCGGGTGG + Intergenic
1117438415 14:55739557-55739579 AAGTGTTCAAAGAGGGAAGGGGG + Intergenic
1117656920 14:57964783-57964805 CATTGGTGAGAGGGGGCAGAGGG + Intronic
1117888268 14:60388557-60388579 CAGGAGCAAGAGAGGGCAGGAGG - Intergenic
1118740710 14:68737483-68737505 CAGAGGTGAGAGAGGGCATCAGG - Intergenic
1118760894 14:68879601-68879623 TAGGGGCCAGCGAGGGCAGGAGG + Intronic
1118908684 14:70043259-70043281 CAAGGGTGAGAGAGGCCAGGTGG + Intergenic
1119106015 14:71924558-71924580 CAGTGGTTACCAAGGGCAGGTGG - Intergenic
1119665658 14:76483252-76483274 CATTTGACAGAGAGGTCAGGTGG - Intronic
1119763915 14:77175998-77176020 CAGGGGTAAGAGAGGGCAGAGGG + Intronic
1119951308 14:78748554-78748576 CAGTGGTCAGATGGGACAGGAGG + Intronic
1120056642 14:79932055-79932077 TAGTGGGCTCAGAGGGCAGGGGG - Intergenic
1120758095 14:88262956-88262978 GAGTGGTCAGAGGCGGCAGCAGG - Intronic
1121220196 14:92279211-92279233 CAGGGGACAGAGAGGGCTTGAGG + Intergenic
1121444740 14:93971372-93971394 ATGTGAGCAGAGAGGGCAGGGGG - Intronic
1121586628 14:95067456-95067478 AAGTGAGCAGAGAGGGCAAGTGG - Intergenic
1121880504 14:97496485-97496507 GAGGGGTGAGAGATGGCAGGAGG + Intergenic
1122053922 14:99079413-99079435 CAGGGTTCAGGGAAGGCAGGAGG + Intergenic
1122863799 14:104594539-104594561 CAGTGGCCCGTGAGGGCCGGAGG - Intronic
1124103164 15:26713894-26713916 CAGGGATCAGAGACGGCTGGTGG + Intronic
1124246361 15:28073853-28073875 CAGGGGTTAAAGATGGCAGGGGG + Intronic
1124949498 15:34303755-34303777 CAGAGGGCAGAGAGGGTAAGAGG - Intronic
1125205675 15:37151368-37151390 CAGAAGTAAGAGAGGCCAGGTGG + Intergenic
1125275031 15:37980120-37980142 CAGAGGCCAGAGAGTTCAGGCGG + Intergenic
1125582114 15:40793520-40793542 CAGTGGTCAGGGTAGGAAGGCGG - Intronic
1125758671 15:42083014-42083036 CAGTGGCCAGAGCGGGCATGGGG - Intronic
1125909189 15:43421032-43421054 CAGTGGTCCGAGAAGGTGGGCGG + Exonic
1126271740 15:46827547-46827569 CAGTGATGAAAAAGGGCAGGGGG + Intergenic
1127817653 15:62625836-62625858 GAGTGGGCAGAGTGGGCAGATGG + Intronic
1127875232 15:63106249-63106271 CAGTGTTAAGACAGGGCATGAGG + Intergenic
1128107574 15:65055898-65055920 CAGAGGCAGGAGAGGGCAGGGGG + Intronic
1128158033 15:65404029-65404051 CCAAGGTCAGAGAGGGAAGGGGG + Intronic
1128656656 15:69467670-69467692 CAGGGGCCAGAGAGGTCAGGGGG - Intergenic
1129210136 15:74063662-74063684 GAGTGGGCAAAGAGGGAAGGAGG - Intergenic
1129403885 15:75301740-75301762 GAGTGGGCAAAGAGGGAAGGAGG + Intergenic
1129823989 15:78622256-78622278 GGGTGGTCAGAGAGGGCAGGAGG - Intergenic
1129842075 15:78750106-78750128 GAGTGGGCAAAGAGGGAAGGAGG + Intergenic
1130577790 15:85107583-85107605 CAGTGGAAGGAGAGGGGAGGGGG + Intronic
1131170510 15:90174848-90174870 GAGTTGTCAGGGAGGGCTGGAGG + Intronic
1132555837 16:572286-572308 CAGTGGTCAGAGAGGGCAGGCGG - Intronic
1132668655 16:1093944-1093966 CAGAGGCCAGAAGGGGCAGGTGG - Exonic
1132679635 16:1134422-1134444 CAGGGATCACGGAGGGCAGGGGG + Intergenic
1132727834 16:1346406-1346428 CAGTGCTCAGCACGGGCAGGGGG - Intronic
1132753587 16:1470912-1470934 CAGGGGGCAGTGAGGGGAGGTGG - Intronic
1132854831 16:2040069-2040091 CAGTGCTGACAGAGGGCGGGCGG + Intronic
1133905538 16:10018877-10018899 CAGTGCTCAGATTGGGAAGGTGG - Intronic
1136618695 16:31413690-31413712 ATGAGGTCAGAGAGGCCAGGAGG - Intronic
1136932606 16:34432684-34432706 CAATGGGAAGAGAGGGCGGGAGG - Intergenic
1136971966 16:34979130-34979152 CAATGGGAAGAGAGGGCGGGAGG + Intergenic
1137491965 16:48940604-48940626 CAGCAGGCAGAGAGGGCAGCTGG + Intergenic
1137679699 16:50329670-50329692 CTGTGGTCAGGAAGGGCAGCCGG + Intronic
1137991590 16:53162213-53162235 CAGTGGGAAGAGAGGCCAGAGGG + Intronic
1138032663 16:53572673-53572695 CAGAGGTCAGAGAGACCTGGGGG - Intergenic
1138533637 16:57648289-57648311 CAGTGGTCAGAGGTGGCAGGAGG + Intronic
1139485352 16:67253116-67253138 ATGTGGTAACAGAGGGCAGGAGG - Intronic
1140720000 16:77763194-77763216 CTGGGGTAAGAGAGGGAAGGAGG - Intergenic
1141620148 16:85232990-85233012 CTGAGGTCAGAGATGGCAGTCGG + Intergenic
1142022376 16:87791801-87791823 GGGAGGTCAGAGAGGCCAGGAGG + Intergenic
1142138556 16:88462434-88462456 CGGGGGTCAGAGAGGGTGGGTGG + Intronic
1142188304 16:88705349-88705371 CAGGGGAGAGAGAGAGCAGGAGG - Intronic
1142715676 17:1745671-1745693 CAGGGGTCAGGGAGGTCAAGGGG - Intronic
1142753976 17:2004670-2004692 CCCTGGGCAGAGAGGGCAGAGGG + Intronic
1143133626 17:4697145-4697167 CAGAGGTCACAGAGGTGAGGAGG + Intronic
1143268480 17:5658366-5658388 TAAAGCTCAGAGAGGGCAGGTGG - Intergenic
1143594270 17:7905057-7905079 CAGTGGTCAGGGAGGGCTCTCGG - Intronic
1144359525 17:14478601-14478623 GAGTGGTCAGCCAGGGAAGGCGG - Intergenic
1144599120 17:16597648-16597670 CTCTGGTCAGCGAGGCCAGGGGG - Intergenic
1144670935 17:17132220-17132242 CACTGGCCAGGGAGGGAAGGAGG - Intronic
1144969110 17:19096065-19096087 CAGTCCTGAAAGAGGGCAGGAGG - Intronic
1144978806 17:19156001-19156023 CAGTCCTGAAAGAGGGCAGGAGG + Intronic
1144989416 17:19222231-19222253 CAGTCCTGAAAGAGGGCAGGAGG - Intronic
1145065651 17:19759740-19759762 CAGGGGGCAGGGAGGGCAGAGGG - Intergenic
1145117866 17:20228299-20228321 CAGTGCTTTGAGAGGCCAGGAGG - Intronic
1145302729 17:21652596-21652618 CAGAGGAGACAGAGGGCAGGAGG - Intergenic
1145347574 17:22050592-22050614 CAGAGGAGACAGAGGGCAGGAGG + Intergenic
1147643962 17:42022671-42022693 CAGTGGTCAGAGAGTTTGGGCGG + Intronic
1147652565 17:42070909-42070931 CAGTGCTGGGAGAGGGCAGTGGG - Intergenic
1148047285 17:44751892-44751914 CAATGGTGAGGAAGGGCAGGGGG - Exonic
1148432220 17:47650831-47650853 CCGGGGTCAGACAGGGCGGGCGG - Intronic
1148638927 17:49170356-49170378 CAGGCATCAGAGAGGGTAGGAGG + Intergenic
1148677511 17:49453748-49453770 CACTGGCCAGAGAGGCCAAGAGG - Intronic
1148779534 17:50113531-50113553 TAGTGGTAATAGTGGGCAGGGGG - Intronic
1148955160 17:51347579-51347601 CTGTGGTGAGAAAGGACAGGTGG - Intergenic
1150021265 17:61615792-61615814 CAACTGTCAGAGAGGGGAGGAGG + Intergenic
1150640855 17:66948506-66948528 CAGTGCCGAGAGAGGGCAGTTGG - Intergenic
1151331815 17:73414561-73414583 GAGGGGACAGAGTGGGCAGGAGG - Intronic
1151887783 17:76933314-76933336 CAGAGGGTAGAGGGGGCAGGCGG - Intronic
1151896909 17:76986734-76986756 CAGGGGACAAAGAGGGCTGGGGG + Intergenic
1152035278 17:77868418-77868440 CAGCGGTGAGGGAGGGGAGGTGG - Intergenic
1152106074 17:78329795-78329817 CTGTGGTCAGAGCTGGCAGAGGG - Intergenic
1152285397 17:79409794-79409816 CACTGGTGAGAGGCGGCAGGGGG + Intronic
1152365623 17:79854700-79854722 CAGTGGGCAGCGTGGGCTGGGGG + Intergenic
1152488124 17:80609002-80609024 AAGAAGTCAGAGTGGGCAGGAGG + Intronic
1152578795 17:81156961-81156983 CACAGGGGAGAGAGGGCAGGAGG + Intronic
1152702499 17:81825980-81826002 CAGTGGTGAGAGCCAGCAGGGGG - Exonic
1153233902 18:2967476-2967498 CCCCGGTCAGGGAGGGCAGGGGG + Intronic
1153321091 18:3774925-3774947 CAGTAGGCAGGGAGTGCAGGAGG - Intronic
1153599114 18:6761636-6761658 CAGTGGTCAGTGAGGGAATTGGG + Intronic
1154134170 18:11761349-11761371 CTGTGCTCTGAGAGGGCATGGGG - Intronic
1157218164 18:45802587-45802609 CAGTGCCCAGAGAAGGGAGGAGG + Intergenic
1157750055 18:50170191-50170213 CAGTGGGCAGTGAGGAAAGGAGG + Intronic
1157893212 18:51438635-51438657 CAGAGGCAGGAGAGGGCAGGAGG + Intergenic
1159827104 18:73226977-73226999 CAGTGAGGAGGGAGGGCAGGGGG - Intronic
1160567664 18:79797359-79797381 GAGTGGTCACAGCAGGCAGGAGG + Intergenic
1160663774 19:313393-313415 CAGGGGCCAGGGAGGGCAGAGGG - Intronic
1160754495 19:750600-750622 CAGGGCTAAGAGAGGTCAGGTGG + Intergenic
1161436725 19:4267909-4267931 GAGTGAGCAGAGAAGGCAGGCGG + Intronic
1162573106 19:11483667-11483689 CAGTGGTCAGGTGGGTCAGGTGG + Exonic
1162584005 19:11547930-11547952 CAGAGGTCATAGAGGCCAGGAGG + Intronic
1162612145 19:11765075-11765097 CTGTGGTCTGAGAGTGCAGTTGG + Intergenic
1162847765 19:13406669-13406691 CACTGGGCAGAGAGGGTGGGTGG + Intronic
1163157208 19:15445996-15446018 AAGCGGGCAGAGAGGGCAGTGGG + Intronic
1163434218 19:17285607-17285629 CAGGGTTCAGCGAGGGCAGTCGG + Intronic
1163469376 19:17487633-17487655 CTGGGGACAGAGAGGGCAGCTGG + Intronic
1164813686 19:31177842-31177864 CACTGCGCAGAGAGGGGAGGCGG + Intergenic
1165244947 19:34493451-34493473 GAGGGGTCAGCGCGGGCAGGAGG - Intronic
1165339522 19:35200788-35200810 CTGTGACCACAGAGGGCAGGAGG - Intergenic
1165993455 19:39828618-39828640 AACGGCTCAGAGAGGGCAGGTGG + Intronic
1166055014 19:40283521-40283543 ATGTGGTCAGAGGGGGCAGATGG - Intronic
1166167889 19:41005153-41005175 CAGTGAGCAGACAGGCCAGGTGG + Intronic
1166367543 19:42284919-42284941 GAGTGGTTAGTGATGGCAGGTGG + Intronic
1166565650 19:43763864-43763886 CAGTGGAGAATGAGGGCAGGCGG + Intergenic
1166571887 19:43802275-43802297 CAGTAGTGAGAAGGGGCAGGTGG - Intronic
1166718699 19:44985423-44985445 CAGTGCTCAGGGAGGGGAGGTGG - Intronic
1167353146 19:48988196-48988218 GAGTGGCCAGACAGGGCAGTGGG - Intronic
1167464913 19:49645599-49645621 CAGTGCTGGGAGAGGGCAGGAGG + Intronic
1168523178 19:57068822-57068844 CAGTGGTAAGAGGAGGCTGGAGG + Intergenic
1168549625 19:57282014-57282036 CAGTGGTTAGGGAGGCCTGGGGG + Intronic
925060795 2:888587-888609 CACTGCTCAGTGAGGGCTGGGGG + Intergenic
925201361 2:1969733-1969755 CAGTGTCCAGAGAGGGCTGCAGG - Intronic
925395403 2:3529890-3529912 CAGTGGACTGACAGGGCTGGAGG - Intergenic
925505363 2:4556375-4556397 CAGTGGCCAGAGACGGGAGAGGG + Intergenic
926259274 2:11242397-11242419 CAGAGCTCAGAAAGGGAAGGAGG + Intronic
927571835 2:24166944-24166966 GAGTGCTGAGAGAGGGCGGGAGG + Intronic
927712224 2:25332970-25332992 CAGTGGGCAGGGAGGGAAAGAGG + Intronic
927826694 2:26314370-26314392 CAGGGGTCAGAGGGACCAGGGGG - Intronic
927893965 2:26769561-26769583 CAGGGGCCAGAGAGGGCTCGAGG - Intronic
928604059 2:32927776-32927798 CAGGAATCAGGGAGGGCAGGAGG + Intergenic
928659795 2:33490609-33490631 TAGAGGTCAGAGAGGGGAGGAGG - Intronic
928660658 2:33499119-33499141 CAGAGGTCAGAAATGGGAGGGGG - Intronic
928948070 2:36789934-36789956 CAGTGGTAACAGAGGGGAGAAGG - Intronic
929581718 2:43085618-43085640 CAGTGGACAGAGATGGGAGCAGG - Intergenic
930048186 2:47192463-47192485 AAGGGGTCTGGGAGGGCAGGGGG - Intergenic
931869030 2:66439848-66439870 CAGTGCTAAGAGAGGGAAGAGGG - Exonic
931882770 2:66583460-66583482 GAGTGGTCGCAGAGTGCAGGTGG - Intergenic
932569409 2:72930526-72930548 GAGAGGTCAGAGTGGGCAAGGGG + Intronic
932836569 2:75043587-75043609 CAGTGATCACCAAGGGCAGGCGG - Intergenic
933990251 2:87628679-87628701 CTGTGGACAGTGAGGGGAGGAGG + Intergenic
934036240 2:88091035-88091057 CAGTGATCAGAGAGGCCTGCAGG + Exonic
934039030 2:88112365-88112387 CAGTGGTCTGAGAGGGAAGGAGG - Exonic
936050186 2:109216660-109216682 CACTGGCTAGAGAGGGCAGGAGG - Intronic
936147159 2:109987598-109987620 CTGTAGTCAGAGAGGCCAGTGGG + Intergenic
936197533 2:110383885-110383907 CTGTAGTCAGAGAGGCCAGTGGG - Intergenic
936303595 2:111322145-111322167 CTGTGGACAGTGAGGGGAGGAGG - Intergenic
936755989 2:115713203-115713225 CAGTCATGAGAGAGGGCAGCTGG + Intronic
936925782 2:117735307-117735329 AAGTGGGGAGAGAGGGAAGGAGG + Intergenic
937080726 2:119137773-119137795 CAGTGGCCAGAGAGGGCAGGTGG + Intergenic
937535738 2:122884503-122884525 CAGTGGTCAGAGAGAACTTGAGG - Intergenic
937961853 2:127466182-127466204 CAGTGCACAGAGAGGCCATGGGG - Intronic
938161475 2:128988362-128988384 AAGAGGTCAGAGAGGGCTTGAGG + Intergenic
938220310 2:129560657-129560679 CAGGGGACAGAGAGAGAAGGAGG - Intergenic
938262756 2:129907037-129907059 CAGTGGGCAGAGCCCGCAGGAGG + Intergenic
938663214 2:133508099-133508121 GGGTGGTCAGAGGGGGCAAGAGG + Intronic
938946354 2:136215725-136215747 CAGAGGTCAGGGAGGTGAGGTGG - Intergenic
943657968 2:190529323-190529345 CAGTGGGCTGGGAGGGAAGGTGG - Intronic
943960112 2:194253852-194253874 CAGTGGTAATAGAGAGCAAGGGG + Intergenic
944824104 2:203463525-203463547 CAGTGGTTAGGGAAGGCAGTGGG + Intronic
945139330 2:206667209-206667231 ATGAGGTCAGAGAGGGAAGGGGG - Intronic
946014424 2:216592589-216592611 CAGTACTCAGAGAGGAGAGGGGG - Intergenic
946179987 2:217943180-217943202 TAGTGGTTGGAGAGGGCAGAGGG + Intronic
946274767 2:218622874-218622896 CAGTGGTAAGAGAAATCAGGTGG + Exonic
946938241 2:224744034-224744056 CAGTGGTCAAACAGGGGAGTTGG + Intergenic
947067102 2:226239980-226240002 CACTGGTGGGAGGGGGCAGGTGG + Intergenic
947074250 2:226324832-226324854 AAGAGGTCAGAGAGGACAGAGGG + Intergenic
947389843 2:229627871-229627893 CAGTGGTGAGAGGCAGCAGGCGG + Intronic
948574023 2:238938279-238938301 CAGTGTCCAGACATGGCAGGAGG + Intergenic
948698175 2:239744262-239744284 CAGTGGGCACAGATGGAAGGAGG + Intergenic
948839878 2:240643624-240643646 CAGGAGACAGAGAGGGCTGGGGG - Intergenic
948941574 2:241199577-241199599 CACTGGGCAAACAGGGCAGGTGG + Intronic
1168774275 20:435019-435041 CTGTGGACAGAAAGGGCATGTGG + Intergenic
1168963576 20:1885453-1885475 GAGTGGTCAGGGTGGGCAGTGGG - Intergenic
1169235547 20:3927031-3927053 CAGAGCTCAGGGAGGCCAGGGGG + Intronic
1169464202 20:5823191-5823213 CAGCAGCCAGTGAGGGCAGGAGG - Intronic
1171088080 20:22257351-22257373 GTGTGGCCAGAGAGGGTAGGAGG - Intergenic
1171519319 20:25764127-25764149 CAGAGGAGACAGAGGGCAGGAGG - Intronic
1171774076 20:29349586-29349608 CAGGGGGCAGAGAGGGGTGGTGG + Intergenic
1171782701 20:29435503-29435525 CAGAGGTTAGAGATGGCAGAAGG + Intergenic
1171816077 20:29787140-29787162 CAGGGGGCAGAGAGGGGTGGTGG + Intergenic
1172119551 20:32589720-32589742 CTGTGGTCAGAGCTGGGAGGGGG - Intronic
1172242597 20:33423326-33423348 CAGAAATCAGAGAGGGGAGGAGG - Intronic
1172882116 20:38208866-38208888 CAGTGCACAGAGAGGGAAGCAGG + Intergenic
1173322560 20:42001433-42001455 CACTGGTGAGAGAGGGCACTAGG + Intergenic
1173460992 20:43243281-43243303 CACTGGGCAGCGAGGGCAGATGG + Intergenic
1173468317 20:43302062-43302084 CAGGGGTCAGACGTGGCAGGTGG - Intergenic
1173519848 20:43691122-43691144 AAGTGGCCAAAGAGGGCAGAAGG - Intronic
1173522569 20:43710674-43710696 CAGTGGAGAGAGACAGCAGGGGG - Intronic
1173595057 20:44253669-44253691 CAGGGGGCAGAGATGGCAGATGG + Intronic
1173617855 20:44414442-44414464 CAGGGGACAGAGAGTGCGGGAGG + Intronic
1173663062 20:44747232-44747254 CAATTGCCAGAGAAGGCAGGTGG - Intronic
1173687931 20:44937129-44937151 CAGTGCTCAATGCGGGCAGGTGG + Intronic
1173826746 20:46052688-46052710 TAGTAATCAGAAAGGGCAGGTGG + Intronic
1175199130 20:57266175-57266197 CAGGTGGCAGAGGGGGCAGGCGG + Exonic
1175957259 20:62617793-62617815 CAGTGGTCAGTGAGGTCAGTGGG + Intergenic
1175962741 20:62645399-62645421 CAGGGGCCAGAGAAGGCAGCAGG - Intronic
1175979971 20:62733765-62733787 CAGAGGAGAGAGAGGGGAGGAGG + Intronic
1175999888 20:62827067-62827089 GAGTGGTCAGAGATGGCTGGAGG - Intronic
1176194070 20:63829121-63829143 TGGTGGTCACAGAGGTCAGGAGG - Intronic
1176273192 20:64247115-64247137 GAGTGCTGAGACAGGGCAGGGGG + Intergenic
1177128548 21:17228027-17228049 CAGAGGTTAGGAAGGGCAGGAGG + Intergenic
1179049799 21:37879439-37879461 CAGTGGGCAGAGTGGTAAGGGGG + Intronic
1179170704 21:38970733-38970755 CCGTGGGAAGAGAGGGCAGGTGG - Intergenic
1179568933 21:42266620-42266642 CAGAGGACAGAGATGGGAGGAGG - Intronic
1179571731 21:42282547-42282569 CAGTGGTCCCAGATGGAAGGAGG - Intronic
1179724681 21:43335511-43335533 CTGGGGTAGGAGAGGGCAGGAGG + Intergenic
1179732756 21:43376596-43376618 CAGAGCTCAGAGGAGGCAGGCGG - Intergenic
1179903498 21:44406998-44407020 CAGAGGTCAGAGTGGGCCGAGGG + Intronic
1180032264 21:45220575-45220597 CACTTGTCTGACAGGGCAGGTGG - Intronic
1180106772 21:45623762-45623784 CAGTGATGAGAGAGGGAAGAAGG - Intergenic
1181319120 22:21991160-21991182 CAGAAGTCAGAGAGGGCAGCTGG - Intergenic
1181633897 22:24165493-24165515 GGGTAGTCAGAGAGGACAGGAGG - Intronic
1181783417 22:25208848-25208870 CAGTGGTCAGTGGGGGGAGGTGG - Intergenic
1181910998 22:26238147-26238169 CATTGGTCAGAGCAGGCAGAAGG + Intronic
1181996083 22:26883842-26883864 CAGGGGCCAGAGAGGGGAGGCGG - Intergenic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1182455544 22:30448067-30448089 TCATGGGCAGAGAGGGCAGGAGG - Intronic
1182488425 22:30653672-30653694 CAGTGCTTAGAGAAGGGAGGCGG - Intronic
1182676239 22:32042130-32042152 CAGTGGGCAGGGAGGGCCTGAGG + Intergenic
1182714169 22:32341510-32341532 CACTGGTCAGCCAGGGGAGGAGG - Intergenic
1182941397 22:34280825-34280847 CAATAGCCAGAGAGAGCAGGTGG - Intergenic
1183076963 22:35433405-35433427 CACAGCTCAGAGAGGGCATGTGG + Intergenic
1183345031 22:37302890-37302912 CAGAGAACAGAGTGGGCAGGGGG + Intronic
1183687320 22:39368597-39368619 CAGTCCTCAGAGAAGCCAGGAGG - Intronic
1184099963 22:42336782-42336804 CAGTCGTGAGGGAGGTCAGGGGG - Intronic
1184142260 22:42584805-42584827 CAGTGGTCAGGGATGCCTGGAGG - Exonic
1184198630 22:42949312-42949334 GAGTTGCCAGAGAGGCCAGGAGG - Intronic
1184242574 22:43218939-43218961 CAGAGGTCAGAGAGAGGAGGAGG - Intronic
1184274730 22:43403922-43403944 CAGTGGGCAAAGGGAGCAGGTGG + Intergenic
1184281739 22:43441336-43441358 CAGTGGGCAGAGGGGACAGTGGG - Intronic
1184458322 22:44623931-44623953 CAGCACACAGAGAGGGCAGGCGG - Intergenic
1184711094 22:46250015-46250037 CTGGGGCGAGAGAGGGCAGGCGG - Intronic
1184760087 22:46538731-46538753 CAGTGGTCGGGGACGGTAGGTGG + Intergenic
1184981534 22:48099281-48099303 CAGTTCTGGGAGAGGGCAGGTGG - Intergenic
1185160991 22:49229773-49229795 CAGTGGTCGGGGATGGCAGTGGG - Intergenic
1185167401 22:49270105-49270127 CTGGGGTCAGAGAGTGCACGGGG + Intergenic
1185206159 22:49540326-49540348 CAGCGGTGAGAAAGCGCAGGAGG + Intronic
1185208391 22:49553210-49553232 CTGTGGGCAGGGAGGGGAGGAGG + Intronic
1185215028 22:49593849-49593871 CAGAAGTCAGAGACTGCAGGAGG + Intronic
949539298 3:5019939-5019961 CTGTGGCCAGAGAGGAAAGGGGG - Intergenic
950260264 3:11538156-11538178 AAGTGGTCAGAGAGAGCATGGGG + Intronic
950266246 3:11575213-11575235 CTGTGGTGCGAGAGGGAAGGCGG + Intronic
950723657 3:14901942-14901964 CAGGGTTCAGAGAAGGGAGGTGG + Intronic
951407995 3:22325328-22325350 TAGTGGTGAGAAGGGGCAGGTGG + Intronic
953694197 3:45145502-45145524 CAGTGGACTTTGAGGGCAGGAGG - Intronic
953732851 3:45464950-45464972 CTGTGGTCAGACAGGGCTGAGGG + Intronic
955055951 3:55456310-55456332 CAGTGAGCAGAGAAGGCAGCTGG - Intergenic
955968609 3:64414079-64414101 CAGTGTTCAAAGAGGGGAGAAGG - Intronic
956314169 3:67915429-67915451 AAGTTTTCAGTGAGGGCAGGAGG - Intergenic
956754085 3:72368374-72368396 CAGGGGGAAGAGAGGGAAGGTGG - Intergenic
956922986 3:73950723-73950745 CAGCGGTCAGAGAGGGCTTCTGG + Intergenic
957135376 3:76281055-76281077 CAGTGATCAGAGATGCCAAGAGG + Intronic
957944842 3:87050913-87050935 ACCTGGTCAGAGAAGGCAGGTGG - Intergenic
958114777 3:89201586-89201608 CAGTGGTCAGAATGGGTAGTGGG - Intronic
959256846 3:104025832-104025854 CAGGGGGCAGGGAGGGAAGGAGG + Intergenic
959632136 3:108518662-108518684 CAGAGGTCAGAGAGTGCTGTTGG - Intronic
960054765 3:113269266-113269288 CAGTGGACAGACACGGCAGCAGG + Intronic
960821702 3:121740046-121740068 CAGTGGTTAGAGAGGGGTTGGGG + Intronic
960997458 3:123349485-123349507 CAGGCGTCAGGGAGGGCAGAGGG - Intronic
962083675 3:132167587-132167609 ATGTGTTCAGAGAGGGGAGGAGG + Intronic
962192110 3:133321821-133321843 CTGTGGTCTGAGAGGGCACTTGG - Intronic
962479432 3:135785782-135785804 CAGGGGACAGAGTGGGGAGGTGG + Intergenic
964664006 3:159152096-159152118 CAGTGGTGAGGGAGGTGAGGTGG + Intronic
965024165 3:163277415-163277437 CAGTGGTCAGAAAGGTAACGGGG - Intergenic
966881771 3:184354690-184354712 CAGTGGAGGGGGAGGGCAGGGGG + Intronic
967248398 3:187512522-187512544 CAGAGGGCAGAGAGGGAAAGAGG + Intergenic
967539999 3:190656293-190656315 CAGAGCTCAGAGAGGGCTGCAGG + Exonic
968658945 4:1791118-1791140 CAGTGGGCAGTGCTGGCAGGAGG - Intergenic
969153116 4:5187122-5187144 CAGTAGTCAGAGAAGCCATGGGG + Intronic
969494859 4:7520720-7520742 CTGTGGGCGGAGAGGGCTGGCGG - Intronic
969696691 4:8738890-8738912 CGGTGGTCAGGGAGGGCATCAGG - Intergenic
969703204 4:8779025-8779047 CAGAGGTCAGGGAGGGCACGGGG - Intergenic
969797430 4:9536944-9536966 ATGTGGTCAGGCAGGGCAGGTGG + Intergenic
970030819 4:11672641-11672663 CAGTGGTGAGGAAGGGCTGGAGG - Intergenic
970454109 4:16204835-16204857 CAGTGGTGAGTGAGGCCAGAAGG - Intronic
970538585 4:17055211-17055233 CAGTGTTGAGAGAGGGCTGGGGG - Intergenic
971236774 4:24849450-24849472 CACTGGACAGAGATAGCAGGAGG + Intronic
971296876 4:25401603-25401625 CAGTGCACGGAGAGGGCAGCTGG - Intronic
972425698 4:38930480-38930502 CACTGCTCAGAGGGGGCATGTGG + Intronic
972832305 4:42828405-42828427 CAGTGGTCAAAGAGCCCAGATGG - Intergenic
973027883 4:45295479-45295501 CTGAGGTCAGAGAGGTCAGGAGG - Intergenic
973330258 4:48905590-48905612 CAGTGGCCACTGGGGGCAGGAGG - Intronic
973989968 4:56395081-56395103 ACCTGGTCAGAGAAGGCAGGTGG - Exonic
974409240 4:61517529-61517551 CGGTGGGGAGAGAGGGCTGGGGG + Intronic
974761773 4:66285545-66285567 CAGTGCTGATGGAGGGCAGGAGG + Intergenic
975783783 4:77866556-77866578 AAGAGGTCAGAGAGGTCAGCTGG - Intronic
976219109 4:82741837-82741859 AAGGGGTCAGAGTGGGCGGGGGG + Intronic
976591223 4:86851483-86851505 CAGTGCTGATAGAGGGGAGGGGG + Intergenic
978279319 4:106990824-106990846 GAATGGTCAGAAAGGGCAAGTGG + Intronic
978475843 4:109128836-109128858 CAGTGGTCAGACAAGCCAGAAGG - Intronic
978562357 4:110046539-110046561 CAGAGCTCACAGATGGCAGGGGG - Exonic
979217142 4:118179500-118179522 AAGTGGTAAGGGAGGGAAGGTGG + Intronic
979541612 4:121890150-121890172 CAGAAGTTGGAGAGGGCAGGGGG + Intronic
980245241 4:130230505-130230527 CAGTGGTAAGAGGGGCCAGATGG + Intergenic
981085186 4:140676209-140676231 CCATGGTCAGAGGAGGCAGGAGG - Intronic
982212585 4:153051227-153051249 CAGTGGCGAGCGGGGGCAGGAGG - Intergenic
982444516 4:155474348-155474370 CTTTGGTCAGACAAGGCAGGCGG + Intergenic
982600470 4:157443230-157443252 CCTTGGTCAGAGACGGCAGCAGG + Intergenic
982618516 4:157674591-157674613 CAGGGTTCAGAGAGAGTAGGAGG + Intergenic
984592954 4:181636906-181636928 CTGAGGTCAGAGAGGTCATGGGG - Intergenic
984766201 4:183402383-183402405 CACTGGGCAGAGAGGGAGGGTGG - Intergenic
984787611 4:183583386-183583408 CACTTGTCAGAGAGGGCCAGTGG + Intergenic
985294282 4:188418057-188418079 CAGTGATCTGAGTGGCCAGGTGG + Intergenic
985637069 5:1041216-1041238 CAGTGGTGAGTGAGGGCTGAGGG + Intergenic
985670756 5:1205438-1205460 CAGTGAACAGAGAGGACTGGGGG - Intronic
985840940 5:2305304-2305326 CCATGGTCAGAGAAGGCAGAGGG + Intergenic
986056583 5:4143282-4143304 GAGTGTTCAGAGAGAGCAGGTGG + Intergenic
986357795 5:6945612-6945634 GAGTGATGAGGGAGGGCAGGAGG - Intergenic
986454090 5:7898474-7898496 CAGTGGTCAGAGGGCTCAGAAGG + Intronic
986903969 5:12470625-12470647 CTGTGGTCTGAGAGAGCAGTTGG - Intergenic
987289417 5:16494541-16494563 CAGGAGTAAGAGAGAGCAGGGGG - Intronic
988200890 5:28066922-28066944 GAGTGGTCACTCAGGGCAGGGGG - Intergenic
988965727 5:36415836-36415858 CAGTGGTTGTATAGGGCAGGAGG + Intergenic
988986957 5:36629861-36629883 CTGTGGTCAGAGAAGGCTGATGG - Intronic
989772496 5:45161433-45161455 CTGTGGTCAGAGATGACAGTGGG + Intergenic
990807658 5:59684171-59684193 CAGTGCTCAGGGAGGGATGGAGG - Intronic
991145324 5:63296264-63296286 CAGAGATTAGAGAGGGCAGTGGG - Intergenic
994289170 5:98007676-98007698 CAGGGGTCAGGAATGGCAGGGGG + Intergenic
997076888 5:130689552-130689574 GAGTGGACGGAGAGGGCTGGTGG - Intergenic
997419243 5:133752750-133752772 CAGGGGTCATAGGGGGCAGGGGG + Intergenic
997750092 5:136336015-136336037 CAGTGGACAGATGTGGCAGGAGG - Intronic
998414876 5:141938791-141938813 TAGGGGCCAGAGCGGGCAGGAGG + Exonic
998432652 5:142079730-142079752 CAGTAGCCACAGATGGCAGGTGG - Intergenic
999175583 5:149629554-149629576 CAGTGACAGGAGAGGGCAGGAGG + Intronic
999275160 5:150325354-150325376 CTATGGTCAGTGAGGGGAGGAGG + Intronic
999452866 5:151691506-151691528 GAGTGGTTGGAGAGGGCAGTGGG - Intergenic
1001057866 5:168464352-168464374 CAGTGTACAGAGAGGGCGGGTGG + Intronic
1001182013 5:169529306-169529328 AAGGGGACAGAGAGGGCAGGAGG - Intergenic
1001600333 5:172924175-172924197 TAGTGCCCAGAGAGGGCAGAGGG - Intronic
1001922831 5:175613941-175613963 CTGTGTTCAGAGAGTGGAGGAGG + Intergenic
1001948297 5:175797741-175797763 CAGACGGCAGAGAAGGCAGGGGG + Intronic
1002595414 5:180318674-180318696 TGGTGGCCACAGAGGGCAGGAGG + Intronic
1003237067 6:4304311-4304333 CTGTGGTCTGAGAGGTCAGAAGG + Intergenic
1003935134 6:10968356-10968378 CAGTGGACAAAGGGGCCAGGAGG + Intronic
1003972173 6:11310306-11310328 CAGTGGGCAGAGAGGGAAGTGGG - Intronic
1003978529 6:11367196-11367218 CAGTGGTCTGAAAGTGCAGTGGG + Intronic
1004657625 6:17679649-17679671 CACTGGTGAGAGAGAACAGGAGG + Intronic
1005282755 6:24291914-24291936 CAATGGGGTGAGAGGGCAGGAGG + Intronic
1005436964 6:25822961-25822983 CAGTGGTGGGGGAGGGCAGGAGG - Intronic
1006093949 6:31644379-31644401 CAGGGGGCAGGGAGGGCAGCTGG + Intronic
1006389140 6:33748337-33748359 CAGAGGTAAGATGGGGCAGGTGG + Intergenic
1006504145 6:34477025-34477047 CAATGGTCAGAGAGGCCTGAGGG - Intronic
1006511418 6:34523552-34523574 CACTGGTGAGAGAAGGCAGATGG + Intronic
1006639850 6:35484320-35484342 AGGTGGTCAGAGAGGACAGTGGG + Intronic
1007285001 6:40741258-40741280 CAGAGTTCAGAGAAGGCTGGAGG - Intergenic
1008535484 6:52503708-52503730 CAGTGGCCACAGAAGGGAGGGGG + Intronic
1008856569 6:56095404-56095426 GAGTGGTCAGAGTTGGGAGGGGG - Intronic
1008966908 6:57322043-57322065 CAGTGGTTGGAGAAGGAAGGTGG + Intronic
1010452482 6:76018470-76018492 CTGTGGATAGAGGGGGCAGGTGG + Intronic
1011131893 6:84060253-84060275 CAGCCTTCAGAGAAGGCAGGTGG - Intronic
1011727716 6:90227523-90227545 GAGGGGTCAGAGCAGGCAGGGGG - Intronic
1014126649 6:117783644-117783666 CAGTGGGCAGAGAGGTCCGTGGG - Intergenic
1014943812 6:127474508-127474530 CAGAGGCCAAAGAGGGCAGGAGG - Intronic
1015379581 6:132551367-132551389 CCCTGGTCAGAGCGGGTAGGAGG - Intergenic
1016050771 6:139527809-139527831 CAGGGGTGACAGGGGGCAGGTGG + Intergenic
1016264192 6:142212761-142212783 CAGGAGACAGAGAGGGAAGGGGG + Intronic
1018900743 6:168050579-168050601 CAGCGGTCGGAGGAGGCAGGAGG + Intergenic
1018998751 6:168729708-168729730 CAGTGGCCTCTGAGGGCAGGAGG + Intergenic
1019281874 7:204697-204719 CAGTGTTCAGGGAGGGGAAGTGG + Intronic
1019281902 7:204839-204861 CAGTGTTCAGGGAGGGGAAGTGG + Intronic
1019311585 7:364437-364459 CAGTGGTGACAGTGGGGAGGGGG - Intergenic
1019423644 7:963157-963179 CAGGTGTCAGCGGGGGCAGGTGG + Intronic
1019567009 7:1688851-1688873 CAGAGGTCAGAGATGGGATGGGG - Intronic
1019605678 7:1909050-1909072 CAGTGGGAACACAGGGCAGGAGG + Intronic
1019608193 7:1920688-1920710 CAGTGAGAAGAGAGGACAGGAGG + Intronic
1022969445 7:35504061-35504083 GTGTGCTCAGAGAGGCCAGGAGG - Intergenic
1023828963 7:44028329-44028351 CTGGGGTCAGAGGGGGAAGGAGG + Intergenic
1024287597 7:47772821-47772843 CAGAGGCTAGAGAGGGCAAGTGG - Intronic
1024564938 7:50673210-50673232 CAGAGGCCAGTGAGGGCAAGGGG + Intronic
1027236317 7:76300178-76300200 CAGTGCTGAGAGGGGCCAGGAGG - Intergenic
1027428742 7:78088325-78088347 CAGAGGTCAGAGAGGAGAGAAGG - Intronic
1027428831 7:78088958-78088980 CAGAGGTCAGAGAGGACAGAAGG + Intronic
1029739262 7:102482586-102482608 CTGGGGTCAGAGGGGGAAGGAGG + Intronic
1029757263 7:102581765-102581787 CTGGGGTCAGAGGGGGAAGGAGG + Exonic
1029775203 7:102680826-102680848 CTGGGGTCAGAGGGGGAAGGAGG + Intergenic
1029910511 7:104141347-104141369 CAGTGGTGAGAGTGGGAATGAGG - Intronic
1030117040 7:106070020-106070042 CAATGGCCAGAGAGGGCTGCGGG + Intergenic
1031659021 7:124397430-124397452 CAGTGGTCTGAGCGGTCAGAAGG + Intergenic
1031868547 7:127066952-127066974 CAGGGCTCAGAGAGGCCAAGTGG + Intronic
1032769992 7:135042504-135042526 CAGGGGTTAGAGGTGGCAGGAGG + Intronic
1034087320 7:148331889-148331911 AAGTTGTGTGAGAGGGCAGGAGG + Intronic
1034338489 7:150338255-150338277 AGGCGGCCAGAGAGGGCAGGGGG - Intergenic
1034895045 7:154871140-154871162 CAGTGGGTAGAGTGGGCTGGAGG - Intronic
1035282676 7:157787472-157787494 CAGTGGGCAGGGCGGGCAGGGGG + Intronic
1035307511 7:157942778-157942800 CTGTCATCAGAGATGGCAGGAGG - Intronic
1035333639 7:158112358-158112380 CAGTGAGCAGAGAAGGCAAGGGG + Intronic
1036001288 8:4607987-4608009 CAGTGGTCAGAGAAGGCATCAGG + Intronic
1037482008 8:19313925-19313947 CAGGGGCCAGAGCGGGCGGGCGG + Intronic
1037906566 8:22719065-22719087 CAGGGGTCAGAGAGGAGAGACGG - Intronic
1038657669 8:29468959-29468981 GAGTGGTCAGATTGGGAAGGAGG - Intergenic
1038697524 8:29819422-29819444 GAGTTGTCAGAGGGGGCAGCAGG - Intergenic
1038935035 8:32240389-32240411 CAGGGGTCAGAGAGTAGAGGAGG + Intronic
1039442003 8:37601591-37601613 CAGTGGTGGGACGGGGCAGGAGG - Intergenic
1040951690 8:52943337-52943359 CAGTGATCAGAAAGCCCAGGAGG - Intergenic
1041537161 8:58939468-58939490 GAGTGGTCTGGGAGGGAAGGAGG + Exonic
1041698675 8:60763894-60763916 CTGTGGTCAGAGAGGAAAAGAGG + Intronic
1044520156 8:93189638-93189660 AAGAGGTCAGGGTGGGCAGGTGG + Intergenic
1045557529 8:103229024-103229046 CAGTGTACAGAGAGGCCAAGGGG - Exonic
1045606078 8:103778410-103778432 CAGAGGCCAGAAAGGGCAGAGGG - Intronic
1046966076 8:120167208-120167230 CAGTGGAAAGAAAGGGGAGGAGG + Intronic
1047937599 8:129797734-129797756 CAGTGGGAAGAGAGAGAAGGGGG + Intergenic
1048079494 8:131110116-131110138 CTGAGGTCAGAGAGGGTATGAGG - Intergenic
1048235582 8:132686658-132686680 CAGTGGTGATAGAGGGAAGTGGG + Intronic
1048522723 8:135171504-135171526 CACTGGTGAGAGAGGACAGGAGG + Intergenic
1048972863 8:139655005-139655027 CAGTGGACAGAGATGGATGGCGG + Intronic
1049129673 8:140827258-140827280 CAGAGGTCAGACAGGAAAGGGGG - Intronic
1049150989 8:141035446-141035468 CAGTGGGGAGCGAGGGCAGGAGG - Intergenic
1049417243 8:142500653-142500675 CTGAGGTCAGAGAGGGAGGGTGG + Intronic
1049676601 8:143891993-143892015 CAGGGGTCAGGGAGGCCACGGGG + Intergenic
1049678220 8:143902979-143903001 CTGTCCTCAGAGACGGCAGGTGG + Intergenic
1049704424 8:144034140-144034162 CATTGGCCAGGGAAGGCAGGAGG + Intronic
1049787644 8:144458707-144458729 CCCTGGTCAGATGGGGCAGGAGG + Intronic
1050293559 9:4181360-4181382 CAGAGTTCAGAGAGATCAGGAGG - Intronic
1050993026 9:12175694-12175716 CAATGGTGAGAGATGGCAGTCGG - Intergenic
1051579281 9:18653290-18653312 CAGTGGTCAGATGGAGGAGGAGG - Intronic
1052857754 9:33417632-33417654 CAGAGGTGAGAGAGGGCAGGAGG - Intergenic
1053484093 9:38439172-38439194 CAGTGGACAGGGAGCACAGGAGG + Intergenic
1055449503 9:76418132-76418154 AAGTGGGCAGAGAGGGGAGGAGG + Intergenic
1056412546 9:86345332-86345354 CAGTGGTAACAGAGGATAGGTGG + Intronic
1056601371 9:88049809-88049831 CAGTGATCACAAAAGGCAGGAGG + Intergenic
1056798966 9:89678188-89678210 CAGGGGTCAAAGAGGGGAGCTGG + Intergenic
1057419016 9:94893391-94893413 GAGGGGTCAGGAAGGGCAGGTGG + Intronic
1057485476 9:95479641-95479663 CACTGGTCAGAGAGAGTTGGTGG - Intronic
1057999407 9:99849902-99849924 AAGTGCTCAGAGACAGCAGGTGG + Intronic
1059296978 9:113279952-113279974 CAGTGGACAGAGAGACCAGAGGG - Intronic
1059415309 9:114158518-114158540 CAGAGGCCAGGGAGGCCAGGAGG - Intronic
1059676858 9:116548276-116548298 AAGGGGACAGAGATGGCAGGAGG + Intronic
1060024856 9:120162309-120162331 CTGAGGTCAAAGAGGGCAGCAGG - Intergenic
1060252324 9:121996208-121996230 TAGAGGTGAGAGAGGACAGGAGG - Intronic
1060404214 9:123365187-123365209 CAGTGGGCAGAGATTGCAGTGGG + Intronic
1060496536 9:124123384-124123406 CAGAGGCCAGAGAAGGCAGATGG + Intergenic
1060540888 9:124429362-124429384 GAGGGCTCAGAGAGGCCAGGTGG - Intergenic
1060705094 9:125791552-125791574 CAGGAGGAAGAGAGGGCAGGGGG - Intronic
1060820399 9:126658415-126658437 CAGGCGGCAGGGAGGGCAGGGGG - Intronic
1060992684 9:127857796-127857818 CAGAGGTCAGAGGAGGCAGGAGG + Intergenic
1061156071 9:128862578-128862600 CAGTGCCCAGAGAAGGCAAGGGG - Intronic
1061310699 9:129760366-129760388 CAGTGGTCAGAAAAGCCTGGAGG + Intergenic
1061427904 9:130512177-130512199 CAGAGGTGAGAGGGAGCAGGAGG - Intergenic
1062170801 9:135133625-135133647 CAGGTGTCAGAGCGGGCTGGAGG + Intergenic
1062254556 9:135614866-135614888 CCCTGGTCAGGGAGGGCAGAGGG - Intergenic
1062362757 9:136195450-136195472 CAGTGGACGGGGAGGGAAGGTGG - Intergenic
1062495458 9:136829480-136829502 CAGTGGTAAGAGGGAGCTGGCGG + Exonic
1062559889 9:137136789-137136811 CAGCTGTCAGAGTGGGCAAGGGG + Intergenic
1062614649 9:137390882-137390904 CAGTGGACGCTGAGGGCAGGGGG + Intronic
1203775549 EBV:71186-71208 CTAGGGTCAGAGAGGCCAGGGGG + Intergenic
1185700052 X:2223942-2223964 AAGTGATCAGAGAGGCCAGATGG + Intronic
1186202833 X:7171348-7171370 GAGAGCTGAGAGAGGGCAGGTGG - Intergenic
1186250450 X:7660331-7660353 CAGTGGTGGGAGAGGGAGGGTGG + Intergenic
1188007589 X:25026761-25026783 CAGAGCTAAAAGAGGGCAGGTGG + Intergenic
1188355189 X:29182115-29182137 CAGAGGTCAGGGAAGGCATGGGG - Intronic
1189308180 X:40002943-40002965 CAGGGTGCAGAGAGGGGAGGAGG + Intergenic
1189373689 X:40449618-40449640 CAGGGCTCAGAGAGTGCTGGAGG + Intergenic
1190437040 X:50435814-50435836 CAGTGGTAGGTGAGAGCAGGAGG + Intronic
1190515189 X:51216513-51216535 CAGAGCTTAGGGAGGGCAGGGGG - Intergenic
1190998582 X:55636535-55636557 CAAGGGCCATAGAGGGCAGGAGG - Intergenic
1191061739 X:56305213-56305235 GAGTGGTGAGAGAGGGCAAGAGG + Intergenic
1192127849 X:68518614-68518636 TAGGGGACAGGGAGGGCAGGTGG + Intronic
1192496136 X:71617734-71617756 CAGTGGGCAGAGAGGGCTCTGGG - Intronic
1192584390 X:72307831-72307853 CTGTGGTCATCCAGGGCAGGAGG + Intergenic
1193746465 X:85288440-85288462 CAGTGGGCACTGAGGGGAGGTGG - Intronic
1195375588 X:104224441-104224463 CAGAGGCCAGAGAGGGGAGTTGG + Intergenic
1195687655 X:107600982-107601004 CAGGGGTGAGAGAAGGCTGGAGG + Exonic
1196742951 X:119041285-119041307 TAGTGGTGAGAGAGGTCAGTTGG + Intergenic
1199599489 X:149533485-149533507 GAGTGGTCTGAGAAAGCAGGTGG + Exonic
1199651142 X:149946722-149946744 GAGTGGTCTGAGAAAGCAGGTGG - Intergenic
1200032761 X:153309728-153309750 CCGTGCTCAGACAGTGCAGGTGG + Intergenic
1200244399 X:154515473-154515495 GAGTGGTGAGAGAGAGGAGGTGG - Intronic