ID: 1132556006

View in Genome Browser
Species Human (GRCh38)
Location 16:572976-572998
Sequence CTGTGTCTGAGGAAGGCGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 293}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132556000_1132556006 7 Left 1132556000 16:572946-572968 CCACTCTTCGTGCAGGCGAGATG 0: 1
1: 0
2: 1
3: 2
4: 51
Right 1132556006 16:572976-572998 CTGTGTCTGAGGAAGGCGAGCGG 0: 1
1: 0
2: 1
3: 25
4: 293
1132555999_1132556006 12 Left 1132555999 16:572941-572963 CCGCTCCACTCTTCGTGCAGGCG 0: 1
1: 0
2: 1
3: 4
4: 76
Right 1132556006 16:572976-572998 CTGTGTCTGAGGAAGGCGAGCGG 0: 1
1: 0
2: 1
3: 25
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132556006 Original CRISPR CTGTGTCTGAGGAAGGCGAG CGG Intronic
900000660 1:13141-13163 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
900020377 1:183660-183682 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
900179144 1:1303735-1303757 CTGGGGCTGAGAAAGGGGAGGGG - Intronic
901108777 1:6778753-6778775 CTGGGTCTCAGGAAGTAGAGGGG + Intergenic
902870197 1:19309486-19309508 CTGTGAGTCAGGAAGGGGAGGGG - Intronic
903176822 1:21586412-21586434 CCGTCTCTGGGGAAGGCGGGTGG + Intergenic
904013511 1:27403753-27403775 TCCTGCCTGAGGAAGGCGAGGGG - Intergenic
904604658 1:31691901-31691923 CCCTGTCTGAGCAAGGGGAGGGG + Intronic
904844219 1:33396647-33396669 TTGTGTCAGAGGAAGGCCATGGG - Intronic
904988950 1:34576117-34576139 CTGTTGCTGAGGAAGGGGAATGG - Intergenic
905468599 1:38175120-38175142 CTGAGTCTGGGGCAGGCAAGAGG + Intergenic
908343288 1:63205024-63205046 CTGGCTCTGAGGAAGGAAAGTGG - Intergenic
909721076 1:78770443-78770465 CTATGTCTGAGTAAGACCAGAGG - Intergenic
911404550 1:97420277-97420299 CTGCGTCGAAGGGAGGCGAGTGG + Intronic
912923035 1:113887512-113887534 CTGTGTTTGAAGAAAGCTAGTGG - Exonic
912965651 1:114235003-114235025 CTGTGACTGAGGAACCAGAGTGG + Intergenic
914944440 1:152051539-152051561 CTGTGCCTGTGGCAGGGGAGGGG + Intergenic
917159586 1:172042734-172042756 ATGTGGCTGATGAAGGAGAGGGG + Intronic
919113307 1:193247407-193247429 CTGTGTCTCAGGAAAAAGAGAGG - Intronic
920382109 1:205541146-205541168 CAGGGGCTGAGGAAGGGGAGTGG - Intergenic
1062795497 10:341991-342013 TTGTGTCTGGGGAATGTGAGTGG + Intronic
1063255257 10:4320671-4320693 CTGTGTTGGAGGAAGATGAGAGG - Intergenic
1063977490 10:11429059-11429081 CTTTGTCTGTGGAAGGCAATAGG - Intergenic
1064769543 10:18710294-18710316 CAGCGGCTGAGGAAGGCGCGCGG - Intergenic
1066105730 10:32155119-32155141 TTGTGTCAGAGGAAGCCTAGTGG - Intergenic
1066454865 10:35564383-35564405 CTGGGGCTGAGCAAGGCCAGTGG - Intronic
1067831137 10:49611650-49611672 GTGGGTTCGAGGAAGGCGAGGGG - Exonic
1069718045 10:70533146-70533168 CTTCCTCTGAGGAAGGCGAGAGG - Intronic
1069738943 10:70675198-70675220 CTGGGTCCATGGAAGGCGAGGGG - Intronic
1069802026 10:71087747-71087769 CTGTAGCTGAGGGAGGAGAGAGG + Intergenic
1070082330 10:73201130-73201152 TTGTTACTGAGGAAGGCAAGAGG + Intronic
1070283836 10:75069599-75069621 CTGGGCCTTGGGAAGGCGAGGGG + Intergenic
1070952773 10:80444284-80444306 CTGTGTGTGAGGCAGGCCTGTGG + Intergenic
1071084670 10:81855688-81855710 TTGTGTCTCAGGAAAGAGAGAGG + Intergenic
1071171325 10:82868191-82868213 TTGTGTCTGAGGACTGCCAGTGG + Intronic
1073529288 10:104216640-104216662 CTGTGGGTGGGGAAGGGGAGAGG - Intronic
1073883466 10:108009594-108009616 TTGTCTCTGAGGAGGGTGAGGGG - Intergenic
1074144495 10:110704618-110704640 CTGTGTAAGAGGAAAGGGAGAGG + Intronic
1074209812 10:111320211-111320233 TTGTGTCTGAACAAGGCTAGTGG + Intergenic
1074629839 10:115240024-115240046 GTGTGTGTGAGGCAGGCGTGAGG + Intronic
1074899570 10:117804497-117804519 GTGTGGCTGAGGCAGCCGAGTGG - Intergenic
1075677746 10:124307998-124308020 CTGTGTCTGGGGAAGGTGTCAGG + Intergenic
1075906341 10:126084883-126084905 CTGAGGCTCAGGAAGGCCAGAGG - Intronic
1076065587 10:127445245-127445267 CTGTGCCACAGGAAGGAGAGTGG - Intronic
1076584987 10:131540892-131540914 CTGCATCTGAGGAGGGGGAGGGG - Intergenic
1076832302 10:133001984-133002006 CTGGGGCTGAGGAAGCTGAGAGG + Intergenic
1077791626 11:5447311-5447333 CTCTGTCTGAGGCAGGGGAGTGG - Intronic
1078161746 11:8846204-8846226 CTATGTCTGGGGAAAGGGAGAGG + Intronic
1078450660 11:11438170-11438192 ATGTATCTGAGTAAGGCCAGAGG - Intronic
1081617669 11:44600238-44600260 CTGGGTCTGGGGAAGCTGAGGGG - Intronic
1082067341 11:47911404-47911426 CTGTGGCAGAGGGAGGGGAGAGG - Intergenic
1082934930 11:58646585-58646607 CTGTGTCAGAGGAATGCTATGGG + Intronic
1084479761 11:69412952-69412974 GTGTTTCTGAGGAAAGCAAGAGG - Intergenic
1085399075 11:76224787-76224809 CAGTGCCTGAGGAAGGTAAGAGG + Intergenic
1085411781 11:76295670-76295692 CAGTGTCCGAGGAAACCGAGAGG - Intergenic
1085474750 11:76782946-76782968 CTGTGTGTGTGGAAAGAGAGAGG - Intronic
1087385280 11:97462103-97462125 GTGTGTCTGAGGAAACTGAGAGG + Intergenic
1088439661 11:109855706-109855728 CTGTGTCTCAGGAAGTAGGGAGG - Intergenic
1088588616 11:111380946-111380968 CTGTGACTGAGGCAGGCCTGAGG - Intronic
1089196487 11:116696513-116696535 CAGGGTATGAGGAAGGGGAGAGG + Intergenic
1089800916 11:121025933-121025955 CTGTGTCTGAGAAATATGAGAGG + Intronic
1090306549 11:125696293-125696315 CAGTGGCTGAGGAATGCCAGGGG - Intergenic
1090527920 11:127557266-127557288 CAGTGTGTGAGGAAGTAGAGGGG + Intergenic
1090909225 11:131104066-131104088 CTGTGTCTGTGCAAGGTGGGTGG - Intergenic
1091090332 11:132764947-132764969 CAGTGTCAGAGGCAGGCGTGAGG - Intronic
1091373758 12:13268-13290 CTGAGGCTGAGGAAGGAAAGGGG + Intergenic
1091748722 12:3009771-3009793 CTGTGTCAGAGGAAGGAGTGGGG - Intronic
1091795187 12:3294087-3294109 CTGAGCCTGAGGAAGGAAAGGGG - Intergenic
1092526446 12:9312784-9312806 ATAAGTCTGAGGAAGGGGAGGGG + Intergenic
1092540831 12:9419001-9419023 ATAAGTCTGAGGAAGGTGAGGGG - Intergenic
1094247119 12:28311335-28311357 CTGTGTCAGAGGAAGCTGAGTGG - Intronic
1094491815 12:30965458-30965480 CTGGGTCAGAGGAAGGCGCTCGG - Intronic
1094512216 12:31103484-31103506 ATAAGTCTGAGGAAGGGGAGGGG + Intronic
1094727224 12:33132647-33132669 CTGTGACTGAAGAAGTTGAGAGG - Intergenic
1094743700 12:33318132-33318154 CTTTGTTTGAGAAAGGTGAGAGG - Intergenic
1096168910 12:49450352-49450374 CTGTGGCTGAGGCAGGAGAATGG - Intronic
1096385607 12:51193023-51193045 CTGTGACACAGGCAGGCGAGAGG + Intronic
1096546182 12:52341643-52341665 CTGTGGCTTAGGAAGGGGAAAGG + Intergenic
1096841655 12:54383549-54383571 CAGTGTTTGAGGAAGGTGAGTGG - Intronic
1098530347 12:71534643-71534665 CTGTTTCTGAGGAATGAGTGAGG - Intronic
1099921394 12:88961702-88961724 CTGGGTCAGTGGAAGGCAAGAGG + Intergenic
1100977830 12:100141064-100141086 CTGGGTATGAGAAAGGCGGGAGG + Intronic
1100985520 12:100199287-100199309 AAGTGTCTGAGGAAGGAGACTGG + Intronic
1101482061 12:105107775-105107797 CTGTGTCTGTGGGAGGCGCCGGG + Exonic
1102566985 12:113803324-113803346 CTGGGTCTGGGGAAGGAGAGTGG - Intergenic
1103191346 12:119004714-119004736 CTGAGTCTGGGGGAGCCGAGAGG - Intronic
1103434219 12:120912390-120912412 ATGTGGCTGAGGCAGGAGAGTGG - Intergenic
1104360729 12:128130289-128130311 ATGTGTGTGAGGCAGGCCAGAGG - Intergenic
1105592864 13:21810733-21810755 CTGTGGCTGAGAAAGGGGAGAGG + Intergenic
1106810446 13:33353400-33353422 CTGTGTCAGAGGAAGGAAATGGG - Intergenic
1107126852 13:36855907-36855929 CTCTGACTGAGGAAGAGGAGAGG - Intronic
1107542311 13:41402837-41402859 CTGAGTGTGAGGGAGACGAGGGG + Intergenic
1108454920 13:50603815-50603837 CTGTGCCTGAGGAGGTGGAGGGG - Intronic
1110310041 13:74038221-74038243 CTGTGTCTGAGGAATGGGAGGGG + Intronic
1111918973 13:94390784-94390806 GTGTGTCTGAAGAAGGGAAGTGG - Intronic
1112579838 13:100669203-100669225 CTGTGTGTGTGGCAGGGGAGAGG + Intronic
1113489881 13:110682945-110682967 CAGTGTCTGAGCAAGTGGAGGGG + Intronic
1114840106 14:26253163-26253185 GTGTGTTTGAGAAAGGGGAGGGG - Intergenic
1117130778 14:52684510-52684532 CTGTGCCTCAGGAAGGACAGTGG - Intronic
1117199497 14:53373721-53373743 CTGTGTCTTGGGAAGCCCAGAGG - Intergenic
1117978215 14:61319151-61319173 CTGGAGCTGAGGAAGGTGAGGGG - Intronic
1118047922 14:61992527-61992549 CTGGGTCTGAGGAGGTCTAGAGG - Intergenic
1118745141 14:68768009-68768031 CTGTGTCTGAGAAGGGCCAAAGG - Intergenic
1122077609 14:99246141-99246163 CTGGGTCCGAGGAAGGCGGGGGG - Intronic
1122211836 14:100178559-100178581 CTGTGGCTGGGGAAGGGGAGTGG + Intergenic
1124840916 15:33241328-33241350 CAGTTGCTGAGGAAGGCAAGAGG + Intergenic
1125379100 15:39068238-39068260 CAGTGTCTGAGTATGGGGAGGGG + Intergenic
1125764286 15:42122924-42122946 CTGTGAATGAGGAAGGAAAGGGG - Intergenic
1127968886 15:63943950-63943972 CTGTGTCTGAGCCAGGCACGAGG - Intronic
1128084724 15:64877859-64877881 CTGTCTCTGGGGAAGGCCAGGGG + Intronic
1128286719 15:66443189-66443211 CTGTGGCTGAGGCAGGAGAATGG - Intronic
1128411863 15:67407477-67407499 CTGTGCCTGAGGAAGATGACAGG + Intronic
1128682813 15:69663873-69663895 CCATGGCTGAGGAAGGCCAGAGG - Intergenic
1128795554 15:70463854-70463876 CCATGTCTGAGGAAGGCTGGTGG - Intergenic
1129239113 15:74241215-74241237 CTCAGTCAGAGGAAGGAGAGGGG + Intronic
1129394230 15:75235544-75235566 CTGTGTCAGAGGCTGGGGAGGGG - Intergenic
1130723112 15:86409509-86409531 CAATGTCTGAGGAAGGCAAATGG - Intronic
1130806118 15:87324981-87325003 ATGTGTGTGAGGCAGGTGAGGGG + Intergenic
1131530839 15:93190438-93190460 CTGTGTGTGGGGAGGGTGAGAGG - Intergenic
1131802511 15:96085762-96085784 CTGTGACTTAGGAAGACAAGGGG + Intergenic
1132452847 15:101977804-101977826 CTGAGGCTGAGGAAGGAGAAGGG - Intergenic
1132454050 16:12822-12844 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
1132556006 16:572976-572998 CTGTGTCTGAGGAAGGCGAGCGG + Intronic
1132686342 16:1163696-1163718 CTGTGTCTGAGGATGGCTTAGGG + Intronic
1135131934 16:19860284-19860306 CTGTGTGTGTGGCAGGGGAGGGG + Exonic
1140469635 16:75206851-75206873 CTGGGGGTGAGGAAGGGGAGCGG + Intronic
1141613042 16:85194318-85194340 CTGTGGCTTAGGGAGGCCAGTGG + Intergenic
1142205876 16:88782930-88782952 CTGTGTCTGGGGATGGGGCGTGG - Intronic
1142275208 16:89114787-89114809 ATGTCTCAGAGGAAGGCGGGGGG + Intronic
1142510034 17:387232-387254 CTGGGTCGGGGGAAGGGGAGTGG - Intergenic
1144209731 17:13003918-13003940 CTGTGAGAGAGGAAGGAGAGAGG - Intronic
1144864031 17:18323532-18323554 CTGGGTCTGAAGGAGGCGATGGG - Intergenic
1146276534 17:31519544-31519566 TTGTGGCTGAGGAAGCCGAGGGG + Intronic
1146884013 17:36459013-36459035 CTGAGGCTGAGGAAGGTGAAGGG + Intergenic
1146970516 17:37068065-37068087 CTGTGTCTGAGGACGCCTGGCGG - Intergenic
1147017947 17:37507428-37507450 CTTTGCCTCAGGAAGGCAAGTGG + Intronic
1147112962 17:38277457-38277479 CTGTGACAGAGGAAGGAGAATGG - Intergenic
1147187907 17:38722570-38722592 CTGGGTCTGAGGGAGTCTAGGGG + Intronic
1148416659 17:47511768-47511790 CTGTGACAGAGGAAGGAGAATGG + Intergenic
1148717816 17:49728365-49728387 CGGAGTATGAGGAAGGCCAGAGG - Intronic
1150446689 17:65231969-65231991 CTGTGTCAGAGAAGGGAGAGGGG + Intergenic
1150561883 17:66302200-66302222 CTGAGGCGGAGGAGGGCGAGAGG + Intergenic
1151350458 17:73528817-73528839 CTGTGCCTGGGGATGGCCAGGGG - Intronic
1151680579 17:75620678-75620700 CTGAGACTGAGGAAGGAAAGGGG + Intergenic
1151921048 17:77155823-77155845 CTGAGGCTGAGGCAGGAGAGAGG - Intronic
1152534729 17:80943871-80943893 CTCTGGCTGAGGAAGGCTTGGGG + Intronic
1152988894 18:344340-344362 CTCTGTCTGAGGAATGCCACTGG - Intronic
1153336205 18:3928084-3928106 CAGTGTGTGTGGATGGCGAGCGG - Intronic
1153949168 18:10043799-10043821 CTTTGTCTGTGGAATGGGAGTGG + Intergenic
1155098289 18:22581394-22581416 TTGTGTATGTGGAAGGAGAGAGG - Intergenic
1155243766 18:23887785-23887807 GTGTGTCTGAGGGAGAAGAGGGG - Intronic
1156061001 18:33076175-33076197 CTGTGTGTGAGCAAGGCGTGGGG - Intronic
1156346728 18:36263687-36263709 CTGTCTCTGTGGATGGGGAGAGG + Intronic
1156519784 18:37712578-37712600 GTGTGTGTGAGGGAGGGGAGGGG - Intergenic
1156717255 18:40026138-40026160 CTGTGTGTGAAGAAAGAGAGGGG + Intergenic
1157595445 18:48861132-48861154 CTGAGTCTGAGAGTGGCGAGTGG + Exonic
1158883806 18:61806469-61806491 CTGTGTTTGTGGAAGGCCTGAGG + Intergenic
1160106388 18:75982333-75982355 ATGTGCCTGAGGAAGGCGGCTGG - Intergenic
1160385290 18:78493056-78493078 CTGTGGCTGAGGAGGGCACGGGG + Intergenic
1160576734 18:79859378-79859400 CTGCATCTGAGGAAGGCCACAGG + Intergenic
1162077027 19:8194733-8194755 GTGTGTCTGAGCAAGGCTATGGG - Intronic
1163035694 19:14567657-14567679 CTGGGTCTGAGGGAGGCGGTGGG - Intronic
1163154768 19:15433644-15433666 CTGGCTCTGAGGATGGCTAGGGG - Intronic
1163228457 19:15980875-15980897 CTGTGTCTGAGGCAGGGATGGGG - Intergenic
1163448293 19:17360604-17360626 CTGGGTCTGTGGAGGGAGAGAGG + Exonic
1163722691 19:18905793-18905815 CTGGGCCTGAGGAAGCTGAGCGG - Intronic
1165952627 19:39482776-39482798 CTGGATCTGAGGAAAGAGAGAGG - Intronic
1166366123 19:42279377-42279399 CTGAGTCTGGGGAAGCCAAGGGG + Intronic
1166833760 19:45654152-45654174 CTCTGTCTGAGGAGGGGGTGCGG + Intergenic
1166992950 19:46704246-46704268 CTGTGGATGAGGAAGGTGTGCGG + Exonic
1167441704 19:49512910-49512932 CTGGGTCTGAGGGAGGAGGGAGG + Intronic
1167659098 19:50785604-50785626 CAGGGTCTGAGGTAGGAGAGTGG - Intergenic
1168253546 19:55154927-55154949 CTGGGTCTGAGGGAGGAGAAGGG + Intronic
1168277401 19:55285273-55285295 CTGAGTCTGAGGGAGGAGGGCGG + Intronic
925001387 2:405585-405607 CTGCGCCTGAGGAAAGTGAGGGG - Intergenic
925293514 2:2763541-2763563 CTGTGTCTGCGTACTGCGAGAGG + Intergenic
927111173 2:19864726-19864748 CTGTGTGAGAGGAAGGGCAGAGG - Intergenic
927887779 2:26729035-26729057 CTGGGGATGAGGAAGGGGAGTGG - Exonic
928090784 2:28373736-28373758 CTCTGTCTCAGGAACGCAAGGGG - Intergenic
929667118 2:43841698-43841720 CTGGGTAAGAGGAAGGGGAGAGG - Intronic
932414120 2:71563632-71563654 TTGGGGCTGAGGAAGGCGGGTGG + Intronic
932812652 2:74837286-74837308 CTGTCTCTGGGGAATGTGAGCGG + Intronic
932921089 2:75916366-75916388 CTGTGCCTGAGGAAAGGGAAGGG - Intergenic
933432164 2:82196916-82196938 CTGGGTCTGTGGAGGGTGAGTGG - Intergenic
934555098 2:95282918-95282940 CTGTGTTTGGGGAGGGCGAGGGG - Intronic
935619643 2:105117586-105117608 GTGGGTATGAGGAAGGGGAGGGG - Intergenic
936088572 2:109486716-109486738 ATGTGTTAGAGGAAGGGGAGGGG + Intronic
937905969 2:127052996-127053018 CTGTTTGCGAGGAAGGGGAGAGG - Intronic
937968995 2:127535594-127535616 CTGGGGCTGAGGGAGGCGTGTGG + Intergenic
938579894 2:132636339-132636361 CTGTGACTGAGGCAGAGGAGTGG - Intronic
941008336 2:160270202-160270224 CGGTGGCTGCGGAAGGCAAGAGG - Intronic
941816276 2:169799080-169799102 CTGAACGTGAGGAAGGCGAGGGG - Intronic
942932784 2:181515791-181515813 CTGTTTCTGAGAAAGGAGAGAGG - Intronic
947531955 2:230914938-230914960 CTGACTCTGTGGAAGGAGAGAGG + Intronic
948789514 2:240370086-240370108 CTGTGTCTGGGGGAGGAGGGTGG + Intergenic
1169569918 20:6894979-6895001 CTGTGTCTGGGGGTGGGGAGGGG + Intergenic
1170700472 20:18698974-18698996 CTGTGTCCAAGGCAGGCCAGAGG + Intronic
1171424344 20:25040247-25040269 CTGTGTCTGTGGCAGCCGAATGG - Intronic
1172076085 20:32298683-32298705 CTGTCTCTGAAGAAGGGAAGGGG - Intronic
1172895958 20:38300146-38300168 CTGTGCCTGAGGATGGAGCGTGG + Intronic
1174038398 20:47682433-47682455 CTGCGTCTGGGGCAGGGGAGCGG - Intronic
1176177098 20:63733867-63733889 CTGTGCCTGAGGAGGCCGTGTGG + Intronic
1178225420 21:30711477-30711499 CAGTGTCTGAGGAAGGGCACTGG + Intergenic
1178710918 21:34916030-34916052 GTGTGTGTGGGGAAGGGGAGAGG + Intronic
1179106860 21:38408806-38408828 ATGTGTAGGAGGAAGGGGAGGGG + Intronic
1179645808 21:42775284-42775306 CTGTGCCTGAGGAAAGCGGGGGG + Exonic
1180189575 21:46155970-46155992 CTGGGGCTGTGGAGGGCGAGAGG + Intergenic
1181179230 22:21055470-21055492 CTGGGTCTCAGCAAGGCCAGAGG - Intronic
1182108186 22:27704225-27704247 CTGGGTCTGAGGAGGCAGAGTGG - Intergenic
1184155732 22:42665588-42665610 CTGTGGCTGATGGAGGAGAGTGG + Intergenic
1184554248 22:45224809-45224831 CTGAGGCTGAGGAAGTAGAGTGG + Intronic
1184555017 22:45228460-45228482 CTCTGCCTGAGGAAGGAGCGAGG - Intronic
949501723 3:4686461-4686483 TTGTGTGTAAGGAACGCGAGGGG + Intronic
952292060 3:32026829-32026851 CTGTTTCTGAGGAAGTGAAGTGG - Intronic
952591065 3:34954253-34954275 CTGTGTATGGGGAAGGAGATAGG + Intergenic
953018420 3:39099059-39099081 CTGTTTCTGAGGAAAGAAAGGGG + Intronic
953079962 3:39607980-39608002 CTGTGTCTGAGGAAGCCCCATGG - Intergenic
955947755 3:64211544-64211566 CTGTGTGTGTGGAAAGAGAGAGG + Intronic
956386450 3:68724909-68724931 CTATCTCTGAGGAGGCCGAGTGG - Intergenic
958134981 3:89477265-89477287 CTCTTTCTCAGGAAGGCTAGTGG - Intronic
960381445 3:116967711-116967733 CTGTGTCTCAGGAAATGGAGAGG + Intronic
961081833 3:124033986-124034008 CTGCGTCTGGGGAGGGCGTGGGG + Intergenic
961123768 3:124397375-124397397 CTGTTTCTGAGGATGGCGTAAGG - Intronic
961487557 3:127227409-127227431 GTGTGGCTCAGGAAGACGAGGGG + Intergenic
962283964 3:134071511-134071533 CTATGTCTGAGGAAGTTGAAAGG + Intronic
963837318 3:150070359-150070381 CTGTGTCCCAGGAAGCCGACTGG + Intergenic
965156868 3:165071385-165071407 CTGTGTCAGATGAAGGCAAAAGG - Intronic
968091619 3:195901560-195901582 GGGTGTCTAAGGAAGGTGAGAGG - Intronic
968737309 4:2304123-2304145 CTGTGTGTGAGGAGGGGCAGGGG - Intronic
970879160 4:20907820-20907842 CGGTGACTGAGGAAGGAGAATGG - Intronic
976059599 4:81111237-81111259 TTGTCTCTCAGGAAGGTGAGTGG + Intronic
976470568 4:85423978-85424000 CTGTGTGTGTGGAAGGGGGGCGG + Intergenic
977697370 4:99981646-99981668 CCCTGTCTCAGGAGGGCGAGGGG - Intergenic
978165828 4:105605381-105605403 ATGTGTGTGAGGAAGGACAGAGG - Intronic
980351676 4:131692294-131692316 CGGTGACTGAGGAAGGAGACTGG + Intergenic
982108579 4:152032634-152032656 TTGAGGCTGAGGAAGGAGAGGGG + Intergenic
982637631 4:157916857-157916879 ATGTGTGTGAGGAGGGAGAGTGG + Intergenic
985440550 4:189980423-189980445 CTGGGTCTGAGGAGGGCGTCAGG - Intergenic
985708459 5:1414895-1414917 CTGTGTCTGGGGAAGGGGGCGGG + Intronic
986345823 5:6834158-6834180 TTATGGCTGAGGAAAGCGAGGGG - Intergenic
986660054 5:10051662-10051684 CTGAGTCTGAGGAGGGTCAGTGG + Intergenic
986737405 5:10678312-10678334 CTGAGTCTGTGGAGGGCGTGTGG + Intergenic
988837622 5:35048516-35048538 ATGTGTCTGAGGAAGGCAAAAGG + Intergenic
989191085 5:38670457-38670479 CTGTCTCTGGGGGAGGGGAGAGG - Intergenic
992610659 5:78505453-78505475 GTGTGTCAGGGGAAGGGGAGGGG + Intronic
993355532 5:86902548-86902570 CAGTGTCTGATGCAGCCGAGAGG - Intergenic
993818746 5:92587093-92587115 CTGTCTCTGAGGAAAGCAAGAGG + Intergenic
994120958 5:96112212-96112234 GTGTGTCTGGGGAAAGCCAGTGG + Intergenic
997571393 5:134930498-134930520 CTGTGTCTGAGAGATGAGAGAGG + Intronic
997699702 5:135888359-135888381 CTCTGTCTGAGGATGGGGAGGGG + Exonic
998179432 5:139926096-139926118 CTGTGTCAGAGGAAGGCCCTAGG - Intronic
998459305 5:142297620-142297642 CTGTGTCAGGGGTTGGCGAGGGG + Intergenic
1003088218 6:3078460-3078482 CTGTGTCTTAGGAATGTGATTGG + Intronic
1003090559 6:3098925-3098947 CAGTGACTGAGAAAGGCGAGGGG - Intronic
1004154483 6:13155435-13155457 CCATGTCTGAGGAAGCTGAGAGG - Intronic
1005899355 6:30204578-30204600 TTGTGTATGGGGAAGGGGAGCGG - Intronic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1007838482 6:44696527-44696549 ATGTGTGTGAGGATGGAGAGAGG + Intergenic
1009755770 6:67938169-67938191 CTGTGTCAGAAGAAAGCAAGTGG - Intergenic
1015627488 6:135195731-135195753 CTGTGTCTAAGGAAGGGGGAAGG - Exonic
1016890483 6:149001640-149001662 CTGTGTCTGAAAAAGGCCAGTGG - Intronic
1018601647 6:165550188-165550210 CTGTGATTGAGGAAGGACAGAGG - Intronic
1019440310 7:1042679-1042701 CTGTGGCTGGGGAATGCTAGAGG - Intronic
1020208560 7:6139800-6139822 CTGTGTGGGAGGAAAGGGAGCGG - Intronic
1020777305 7:12471085-12471107 CTGAACCTGAGGAAGGCGAGGGG - Intergenic
1023522815 7:41065845-41065867 CTGTGGGTGGGGAAGGCGGGAGG + Intergenic
1023708052 7:42963067-42963089 CTTTGTGTGAGAAAGGTGAGAGG - Intergenic
1024377799 7:48658872-48658894 CTGTGTCCAAGGAAAGGGAGTGG - Intergenic
1026497172 7:70913259-70913281 CTCTTTCTCAGGAAGGCCAGTGG + Intergenic
1026955489 7:74373863-74373885 CTGGGGCTGAGGAAGGGGTGGGG + Intronic
1031982444 7:128136422-128136444 CTGTGTCTGAGCAAGGAGGGTGG - Intergenic
1032240171 7:130153833-130153855 CTGTGGGGGAGGAAGGAGAGTGG + Intergenic
1033234464 7:139626997-139627019 CTGTGCCCCAGGAAGGGGAGAGG + Intronic
1034277201 7:149829176-149829198 CTGGGTCTGAGGGAAGCGTGTGG - Intergenic
1034527724 7:151676231-151676253 ATGTATCTGAGGAGGGGGAGGGG + Intronic
1034822530 7:154230161-154230183 CTGTGTGGGAGGATGGGGAGAGG - Intronic
1035253084 7:157609994-157610016 CTGCATCTGAGGAAAGCGTGTGG + Intronic
1035425481 7:158769351-158769373 CTGTGTGTGAGAAAGGTGGGTGG - Intronic
1037665908 8:20969963-20969985 CTGTGGCACAGGAAGGAGAGAGG - Intergenic
1037903839 8:22703799-22703821 CAGTCTCTGAGGAGGCCGAGCGG - Intergenic
1038357432 8:26842462-26842484 CTGCGTCTGAGGAATCAGAGTGG - Intronic
1038376702 8:27047276-27047298 TTGTGTCTGAGGATGACAAGAGG + Intergenic
1041712475 8:60906965-60906987 CTGTGTCTGAGTCAGGAGATGGG + Intergenic
1041732680 8:61078026-61078048 CTGGGGCGGAGGAAGCCGAGGGG + Intronic
1041745882 8:61208921-61208943 CTGTGTCTTAGGAATCCAAGAGG - Intronic
1041893851 8:62901733-62901755 ATGTGTCTGTGGAAGTTGAGAGG - Intronic
1042835048 8:73072108-73072130 CTGTGTGAGAGGAAGGAGAGGGG + Intronic
1044260779 8:90117710-90117732 CTGAGGCTGAGGCAGGAGAGTGG + Intergenic
1048972886 8:139655116-139655138 CAGTATCTGAGGGAGGGGAGTGG - Intronic
1049335346 8:142081601-142081623 CTGAGACTGAGGAAGGCAAGTGG + Intergenic
1049354816 8:142182438-142182460 CTGTGGCTGTGGACGGTGAGAGG + Intergenic
1049495309 8:142928137-142928159 CTGTGTCTGAGTTTGGCCAGTGG + Intergenic
1049555514 8:143279444-143279466 CTGGGTCGGAGGAGGGAGAGGGG - Intergenic
1049883470 9:13254-13276 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
1049920708 9:361180-361202 CTGTGACAGAGGAAGGCAGGGGG + Intronic
1052352657 9:27473308-27473330 CAGTGTCTGAGGGAGGCAAAGGG + Intronic
1053034480 9:34812592-34812614 CTGTCTCTGAGGAAGCAGACTGG + Intergenic
1053274312 9:36771649-36771671 CTTAGTCTGAGGGAGGAGAGGGG - Intergenic
1055471584 9:76617256-76617278 CTGTCTCTGAGGAAAATGAGAGG + Intronic
1056520300 9:87395160-87395182 CTGTGTGAGAGGCAGGGGAGAGG - Intergenic
1056761873 9:89421169-89421191 CTGTGGCTGTGGACGGGGAGAGG + Intronic
1057066736 9:92060040-92060062 CAGTGTCACAGGAGGGCGAGTGG + Intronic
1058928021 9:109687925-109687947 CTGTGTCTCAGGAAATAGAGAGG + Intronic
1059921528 9:119165917-119165939 CTGTGTGTGGGGAACGGGAGTGG + Intronic
1060120912 9:120988524-120988546 GTGTGTTTGAGGAAGGCTAGTGG + Intronic
1060128621 9:121074604-121074626 CTGTGTCCGAGGACGGCCTGAGG - Intergenic
1060790672 9:126483529-126483551 CTGTGTCTGGGTAAGGCAGGAGG - Intronic
1060828733 9:126700837-126700859 ATGTGTCTGGGGATGGCGGGTGG - Exonic
1061517376 9:131097473-131097495 GTGTGTTTGAGGGAGGCGGGAGG - Intronic
1062431617 9:136529053-136529075 CTGGGTCTGGGGAGGGCGTGGGG - Intronic
1062444349 9:136587459-136587481 CCGTGTCTGAGGGAGGCGCCCGG - Intergenic
1186789569 X:12983769-12983791 GTGGGTCTGTGGAAGGAGAGAGG + Intergenic
1187913207 X:24129478-24129500 CAGGGGCTGAGGAAGGGGAGGGG + Intergenic
1192261365 X:69507417-69507439 CTGAGGCTGAGGGAGGCGGGAGG - Intronic
1194024534 X:88735640-88735662 CTGTGTCTGGGGAGGGTGGGTGG + Intergenic
1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG + Intronic
1196141032 X:112263754-112263776 CTGTGTGTGAGGGAGGGGTGAGG - Intergenic
1199704370 X:150411257-150411279 CTTTGGCTGAGGAAGGGGAACGG - Intronic
1200402346 X:156026895-156026917 CTGAGGCTGAGGAAGGAGAAGGG - Intergenic
1201695008 Y:16815205-16815227 CTTTGTGTGAGGAAGGTAAGAGG + Intergenic