ID: 1132556554

View in Genome Browser
Species Human (GRCh38)
Location 16:575241-575263
Sequence CTGTGATTGTGGAGAGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 292}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132556554_1132556558 -7 Left 1132556554 16:575241-575263 CCTGCTTCTCTCCACAATCACAG 0: 1
1: 0
2: 2
3: 26
4: 292
Right 1132556558 16:575257-575279 ATCACAGGTGCTGCTGGCCAAGG 0: 1
1: 0
2: 2
3: 35
4: 646
1132556554_1132556569 28 Left 1132556554 16:575241-575263 CCTGCTTCTCTCCACAATCACAG 0: 1
1: 0
2: 2
3: 26
4: 292
Right 1132556569 16:575292-575314 CCAAGGGCCCTGAGGGGCACGGG 0: 1
1: 0
2: 5
3: 31
4: 344
1132556554_1132556570 29 Left 1132556554 16:575241-575263 CCTGCTTCTCTCCACAATCACAG 0: 1
1: 0
2: 2
3: 26
4: 292
Right 1132556570 16:575293-575315 CAAGGGCCCTGAGGGGCACGGGG 0: 1
1: 0
2: 2
3: 35
4: 245
1132556554_1132556567 27 Left 1132556554 16:575241-575263 CCTGCTTCTCTCCACAATCACAG 0: 1
1: 0
2: 2
3: 26
4: 292
Right 1132556567 16:575291-575313 CCCAAGGGCCCTGAGGGGCACGG 0: 1
1: 1
2: 2
3: 43
4: 369
1132556554_1132556561 11 Left 1132556554 16:575241-575263 CCTGCTTCTCTCCACAATCACAG 0: 1
1: 0
2: 2
3: 26
4: 292
Right 1132556561 16:575275-575297 CAAGGGTCAGTTGAAGCCCAAGG 0: 1
1: 0
2: 0
3: 14
4: 152
1132556554_1132556562 12 Left 1132556554 16:575241-575263 CCTGCTTCTCTCCACAATCACAG 0: 1
1: 0
2: 2
3: 26
4: 292
Right 1132556562 16:575276-575298 AAGGGTCAGTTGAAGCCCAAGGG 0: 1
1: 0
2: 1
3: 16
4: 191
1132556554_1132556563 20 Left 1132556554 16:575241-575263 CCTGCTTCTCTCCACAATCACAG 0: 1
1: 0
2: 2
3: 26
4: 292
Right 1132556563 16:575284-575306 GTTGAAGCCCAAGGGCCCTGAGG 0: 1
1: 0
2: 1
3: 22
4: 194
1132556554_1132556559 -6 Left 1132556554 16:575241-575263 CCTGCTTCTCTCCACAATCACAG 0: 1
1: 0
2: 2
3: 26
4: 292
Right 1132556559 16:575258-575280 TCACAGGTGCTGCTGGCCAAGGG 0: 1
1: 0
2: 1
3: 26
4: 218
1132556554_1132556564 21 Left 1132556554 16:575241-575263 CCTGCTTCTCTCCACAATCACAG 0: 1
1: 0
2: 2
3: 26
4: 292
Right 1132556564 16:575285-575307 TTGAAGCCCAAGGGCCCTGAGGG 0: 1
1: 0
2: 0
3: 23
4: 173
1132556554_1132556565 22 Left 1132556554 16:575241-575263 CCTGCTTCTCTCCACAATCACAG 0: 1
1: 0
2: 2
3: 26
4: 292
Right 1132556565 16:575286-575308 TGAAGCCCAAGGGCCCTGAGGGG 0: 1
1: 1
2: 2
3: 13
4: 214
1132556554_1132556571 30 Left 1132556554 16:575241-575263 CCTGCTTCTCTCCACAATCACAG 0: 1
1: 0
2: 2
3: 26
4: 292
Right 1132556571 16:575294-575316 AAGGGCCCTGAGGGGCACGGGGG 0: 1
1: 0
2: 3
3: 14
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132556554 Original CRISPR CTGTGATTGTGGAGAGAAGC AGG (reversed) Intronic
900518292 1:3093650-3093672 CTGTGGTCGTGGTGAGAAGGAGG + Intronic
900914840 1:5629558-5629580 CTGTGATGATGGAGTGGAGCTGG + Intergenic
901029831 1:6300633-6300655 CTGTGTTTGTGGAGAGAGGCCGG - Intronic
901029873 1:6300817-6300839 CTGTGTTTGTGGAGAGGGACCGG - Intronic
901255048 1:7817142-7817164 CTATGATTGGGTAGAGAAGGAGG + Intronic
901672742 1:10865888-10865910 CTGGGAATGGGGAGAGAAGAAGG + Intergenic
902783930 1:18721082-18721104 GAGGGAGTGTGGAGAGAAGCTGG - Intronic
903104595 1:21064794-21064816 CTGTCCTTGTGGTCAGAAGCAGG + Intronic
903589158 1:24441127-24441149 CAGTGCTGGTGGAGTGAAGCCGG - Intronic
903801999 1:25975933-25975955 CTGTGATCAGAGAGAGAAGCAGG - Intronic
904043147 1:27595591-27595613 CTGTGGTTTTGGGGAGGAGCTGG + Intronic
904886659 1:33743358-33743380 TTGTGATGGAGGAGGGAAGCTGG + Exonic
905598431 1:39229467-39229489 CTGGGCTTGGGGAGAGAACCTGG + Intronic
907316286 1:53574788-53574810 CTGTGAATGTGGTAAAAAGCTGG + Intronic
908285539 1:62594807-62594829 GTGTAATAGGGGAGAGAAGCTGG + Intronic
910937365 1:92495303-92495325 TTGTGATTAAGGAGAGAAGTGGG - Intergenic
911497100 1:98644955-98644977 ATGTGATTATGGAGAGAGACAGG - Intergenic
912505457 1:110152649-110152671 CTGTGATTGTGGTCAGAACTGGG + Intronic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
913314906 1:117541316-117541338 CTCTGTTTGTGGAGAAAAGAAGG + Intergenic
913547902 1:119887600-119887622 ATGTGTTTGTGAAGAGAAGAAGG - Intergenic
915177007 1:154024107-154024129 GTGGGAATGTGAAGAGAAGCTGG + Intronic
916239448 1:162624362-162624384 CTGGGAATGCGGAAAGAAGCTGG - Intergenic
917191317 1:172422229-172422251 CTTTGCTTGAGGAGAGAAGAGGG + Intronic
917479074 1:175394997-175395019 CAATGATTGTGCAGAGAGGCAGG - Intronic
918039960 1:180907984-180908006 GTGTGTGTGTGGAGTGAAGCAGG + Intergenic
920766069 1:208835130-208835152 CTGTGTGTGTGGGGAGAGGCAGG - Intergenic
922885766 1:229019349-229019371 CATTGATGGGGGAGAGAAGCTGG + Intergenic
923028961 1:230231479-230231501 CTGTGTTATTGGACAGAAGCTGG + Intronic
923162203 1:231324177-231324199 CTGTGGTGGTGGGGGGAAGCGGG + Intergenic
923275898 1:232396062-232396084 CAGTGAAAGTGGAGAGAAGTAGG - Intergenic
923958960 1:239055619-239055641 CTATGCTTGTGGGGAGAAACAGG - Intergenic
1064478565 10:15718417-15718439 CTTTGACTGTGGAGAGAATTTGG - Intronic
1064555646 10:16544717-16544739 GTGTGAATGAGGAGAAAAGCTGG + Intergenic
1067265035 10:44734414-44734436 CTGTCATTGGCCAGAGAAGCAGG + Intergenic
1069776152 10:70928467-70928489 CTGTGTTTGGGGAGGGGAGCAGG + Intergenic
1069861433 10:71474108-71474130 CTGGCATTGTGGAGAGGAGGTGG - Intronic
1071292654 10:84198600-84198622 CTGTGGTGGTGGAGAGCAGGTGG - Intronic
1073305399 10:102499985-102500007 GTGTGTGTGTGGAGAGAAGTGGG + Intronic
1074744128 10:116514642-116514664 CTGTGATGGGGGAGGGAAGTGGG + Intergenic
1075005010 10:118823809-118823831 CTGTGTTTATGGAGAGGGGCTGG + Intergenic
1075680107 10:124325478-124325500 CTATGATCGTGGAGAGAGGAGGG + Intergenic
1076550500 10:131274857-131274879 CTGGGATTGTGGATGGAGGCAGG - Intronic
1076718973 10:132384612-132384634 CTGAGACGGTGGAGAGAAACAGG - Intergenic
1077465246 11:2730860-2730882 CTGTGGCTGTGGCCAGAAGCAGG + Intronic
1078919892 11:15819980-15820002 CTGTGGGTGTGGAGTCAAGCAGG - Intergenic
1079107499 11:17580916-17580938 CTGTGGTTGTGGGAGGAAGCAGG - Intronic
1083950195 11:65950318-65950340 CTGGGTTTGTGGGGAGAAGAAGG - Intronic
1085518861 11:77126635-77126657 GTGTGGTGGTGGGGAGAAGCAGG + Intergenic
1086111179 11:83200098-83200120 GGGTGATTTTGGAGAGAAGGGGG + Intronic
1086596851 11:88582864-88582886 ATGTGATTGTGGAGAGAGACAGG + Intronic
1087111790 11:94477863-94477885 CTGGGCTTTTGGAAAGAAGCGGG - Intronic
1088627768 11:111744023-111744045 CTGTGTAAGTGGAGAGAAGCGGG + Intronic
1088678799 11:112221893-112221915 CTGTTTTAGTGGAGAGAGGCAGG + Intronic
1090366620 11:126211829-126211851 CGGTGAGTGTGTAGGGAAGCCGG + Exonic
1090800370 11:130167608-130167630 CTGTGATAGGGGAGGGAAGGGGG - Intronic
1091109489 11:132952565-132952587 CTGTGATAGAAAAGAGAAGCAGG - Intronic
1091415158 12:276539-276561 CTGAGACTGTTGAGAGATGCTGG + Intergenic
1092008543 12:5089226-5089248 CTGTGGTTGTGCAGAGCACCAGG - Intergenic
1092264382 12:6969970-6969992 CTGTGGTCGTGGAGAGGAGCAGG - Intronic
1092662909 12:10758181-10758203 CTGTCTTTGTGGAGAGAAATGGG + Intergenic
1093296225 12:17395358-17395380 CTTTGATTTGTGAGAGAAGCGGG + Intergenic
1094052630 12:26237941-26237963 GTGTGATTGTAGAGAGCAGGAGG + Intronic
1094241395 12:28229819-28229841 CTGTGTTTGTGGCTAGAAGAAGG + Intronic
1094292439 12:28867052-28867074 AGGTGATGGTGCAGAGAAGCAGG - Intergenic
1096836858 12:54356727-54356749 GTGGGATTGTGGTGAGAAACTGG - Intergenic
1097005617 12:55915330-55915352 CTGTATTTGTGGAGATAACCAGG - Intronic
1097187347 12:57202903-57202925 CTGTGTTTGGGGAGGGGAGCGGG - Intronic
1097966531 12:65587364-65587386 CGGTCATTATGGAGGGAAGCAGG + Intergenic
1098015774 12:66103202-66103224 GAGTGCTTGTGGAGAGAAGAAGG + Intergenic
1099631514 12:85152317-85152339 CAGTGTTTGTGAAGGGAAGCGGG - Exonic
1101681996 12:106977958-106977980 CTTTGAGTTTGGATAGAAGCTGG + Exonic
1101855237 12:108436794-108436816 CTGTGATTGCTGAGAGAGACTGG - Intergenic
1102397233 12:112597178-112597200 CTGTGATTGTTGAGAAAAGACGG + Intronic
1104217692 12:126750211-126750233 CAGTCACTGTGGAGAGAGGCAGG + Intergenic
1104512518 12:129393427-129393449 CTGTGATTCTGGAAAGAAACAGG - Intronic
1107114043 13:36727211-36727233 CTGTTATTGTGGAGGGAACAGGG - Intergenic
1107982927 13:45750649-45750671 CTGTGCTTGTGGAGAGACAGAGG + Intergenic
1108552782 13:51563245-51563267 CAGAGGTTGTGGAGAGAAGGGGG + Intergenic
1109300528 13:60585712-60585734 CCGAGACTGTGGGGAGAAGCAGG + Intergenic
1110299768 13:73912857-73912879 CTGTGAGTGAGGGGAGAAGAAGG - Intronic
1110363492 13:74655856-74655878 GTGTGCTTGTGGACAGAAGAGGG + Intergenic
1112348144 13:98609921-98609943 CTGTTTTTGTGGGGAGAAGGGGG - Intergenic
1112788180 13:102974561-102974583 CATTCATTGTGGAGAGAAGGAGG + Intergenic
1113657245 13:112074687-112074709 CGTTGTTTGTGGAGAGCAGCAGG + Intergenic
1114277123 14:21156752-21156774 CTGAGAGTGTGGAGAGATGGAGG + Intergenic
1121070875 14:91019539-91019561 CTGTGATTATGGAGACTGGCAGG - Intronic
1122158606 14:99766769-99766791 CTGGGATTGTGGAAATCAGCTGG - Intronic
1122297620 14:100714136-100714158 CTGTGGTTGCAGAGGGAAGCCGG - Intergenic
1122898161 14:104770692-104770714 CTCTGAGTGTGGAGAGAAAAGGG + Intronic
1123881556 15:24680905-24680927 TTGAGATTGTAGATAGAAGCAGG + Exonic
1124657096 15:31517457-31517479 CTGGGATTGTGGGGAGAATCTGG + Intronic
1126432571 15:48601885-48601907 CCGTGAATGTGGAGAGATGGAGG - Intronic
1126556235 15:49990720-49990742 CTATGATTTTCCAGAGAAGCTGG + Intronic
1126568866 15:50128572-50128594 ATGCCATTCTGGAGAGAAGCAGG + Intronic
1126856203 15:52841784-52841806 CAGTGAATCTGGAGAGCAGCAGG + Intergenic
1128253855 15:66182874-66182896 CGTTTATGGTGGAGAGAAGCTGG + Intronic
1128525705 15:68410889-68410911 CTCTGACTCTGGGGAGAAGCAGG + Intronic
1128774798 15:70311995-70312017 CTGTGATTGAGGAGGGAACAGGG - Intergenic
1129726043 15:77902260-77902282 CTGTGTTTGTGGTGAGGACCGGG - Intergenic
1129763823 15:78148514-78148536 CTGGGATTGAGGACAGGAGCGGG + Intronic
1130103502 15:80912004-80912026 CTGTGATTGCTGGGAGAGGCTGG + Intronic
1131225133 15:90618331-90618353 CAGTAATTCTGGACAGAAGCTGG - Intronic
1131498651 15:92937987-92938009 ATCTGATTGTGTAGAGAAGGAGG + Intronic
1132153167 15:99476518-99476540 CTGGGCTTGGGGAGAGATGCTGG - Intergenic
1132501499 16:286472-286494 CTGTGAGTGTTGAGGGAGGCAGG + Exonic
1132556554 16:575241-575263 CTGTGATTGTGGAGAGAAGCAGG - Intronic
1132663665 16:1072392-1072414 CTGGGGTTGTGGAGATAAGTGGG - Intergenic
1133374546 16:5273588-5273610 CTGTGTTTAAGGTGAGAAGCGGG + Intergenic
1136121319 16:28137087-28137109 CTGGGAATGTGGAATGAAGCTGG - Intronic
1136452347 16:30360448-30360470 CTGTGGAGGTGGAGAGGAGCAGG - Intronic
1138090780 16:54172538-54172560 ATGTAATTATAGAGAGAAGCAGG - Intergenic
1140733082 16:77873970-77873992 CTCTGGTTCTGCAGAGAAGCAGG - Intronic
1141785263 16:86195456-86195478 CTGTGGTTTTGGAGAGGACCTGG - Intergenic
1141859937 16:86709670-86709692 CAGTGAAGCTGGAGAGAAGCAGG + Intergenic
1143042898 17:4052511-4052533 CTGTGATTCTGGAGTGAAAAAGG - Intronic
1143488084 17:7266231-7266253 CAGTGAGTTTGGAGAGAAGCTGG - Intergenic
1143906767 17:10215496-10215518 CAGTAATTCTGGAGAGCAGCTGG - Intergenic
1144242069 17:13322431-13322453 CTCTCATTGTGGAGATAAGAGGG - Intergenic
1145023905 17:19453356-19453378 CTGTGGCTGTGGACAGGAGCTGG + Intergenic
1146561104 17:33871401-33871423 TTGACACTGTGGAGAGAAGCTGG - Intronic
1147133173 17:38420539-38420561 CTGTGATGGTGGTGAGGAGAGGG + Intergenic
1148612361 17:48972789-48972811 ATGTGACTGTGGGGAAAAGCTGG - Intergenic
1151419657 17:73988792-73988814 CTATGACTGTGGAGAGAACAGGG + Intergenic
1152231778 17:79117522-79117544 GTGTGGGTGTGGAGGGAAGCGGG - Intronic
1152532125 17:80924789-80924811 GTGTGCTTGTGGAGTGAGGCTGG - Intronic
1153054742 18:934760-934782 CTTAGATCCTGGAGAGAAGCAGG + Intergenic
1153946042 18:10018327-10018349 GTGTGATTGTGAAGGGATGCTGG + Intergenic
1154158374 18:11960966-11960988 CTGTGAGGGTGGAGAGAGGAGGG + Intergenic
1156129396 18:33952130-33952152 ATGTGTTTGTGGTGGGAAGCTGG + Intronic
1156315913 18:35968520-35968542 CTGTGGTGGTGCAGAGAAGCGGG + Intergenic
1156610014 18:38714766-38714788 CTGCGTATGTGGAGGGAAGCTGG + Intergenic
1158745222 18:60192021-60192043 TACTGATTGTGAAGAGAAGCTGG + Intergenic
1159225077 18:65523189-65523211 CTGTGCTTGAAGAGAGAAGAGGG + Intergenic
1159446252 18:68544926-68544948 CTCTGCTTGAGGAGAGAAGAGGG + Intergenic
1159937192 18:74378614-74378636 GTCTGCATGTGGAGAGAAGCTGG - Intergenic
1160816143 19:1036643-1036665 CTGAGAGTGGGGAGAGAAGCTGG - Intronic
1161199361 19:3005969-3005991 CTGGGGTCGGGGAGAGAAGCAGG + Intronic
1161720281 19:5898442-5898464 CTGTGCTTGTGGGGAGCAGATGG - Intronic
1162401398 19:10448894-10448916 CTGTGATTGAGGACAGAGGCAGG - Intronic
1163202689 19:15779974-15779996 CAGGGACAGTGGAGAGAAGCAGG + Intergenic
1163620640 19:18357802-18357824 CCGTGATGGTGGGGAGAAGTGGG - Intronic
1164503772 19:28841376-28841398 CTGTGTGTGTGGGGAGAAGGTGG + Intergenic
1164676104 19:30102845-30102867 CTGTGAGGATGGTGAGAAGCTGG - Intergenic
1164753976 19:30676339-30676361 CTGTGAATGTGTAAAGAAGATGG + Intronic
1164859444 19:31551248-31551270 CTGTGAGAGGGGAGAGAAGGAGG - Intergenic
1165070951 19:33254549-33254571 CTGTGCTGGTAGAGAGAGGCTGG + Intergenic
1165749903 19:38253305-38253327 CTGGGATTCGGGAGAGGAGCTGG + Intronic
1166303472 19:41924828-41924850 CGGTGTTTCTGGAGAGAAGCAGG + Intronic
1166485283 19:43206750-43206772 GTGTGCTTGTGGGGAGAAGGGGG - Intronic
1167005644 19:46774983-46775005 CTGTTATTGTGGAGGGAATAGGG + Exonic
1168126101 19:54284053-54284075 CTGTGTTTGTGGACAGACCCTGG + Intergenic
1168171186 19:54590736-54590758 CTGTATTTGTGGACAGAATCTGG - Intronic
1168175835 19:54627024-54627046 CTGTGTTTGTGGACAGACCCTGG - Intronic
925366851 2:3316554-3316576 CTGTGAGTTGGGAGAGAGGCAGG - Intronic
925745198 2:7038269-7038291 CTGAGATAATGGAGACAAGCAGG - Intronic
925760672 2:7181407-7181429 CTGTGCTGGGGAAGAGAAGCAGG - Intergenic
925876067 2:8312226-8312248 CTGTGAATGTAGAGAGCAGGAGG - Intergenic
925955544 2:8960554-8960576 CTATGGTTGTGGAGATCAGCGGG - Intronic
927219557 2:20694673-20694695 CTGTGCCTGCAGAGAGAAGCAGG - Intronic
927249218 2:20982907-20982929 CTGTGAGTGGGGAAAGAATCAGG + Intergenic
929112025 2:38413097-38413119 ATGGGAATGTGGAGAGAAGCAGG + Intergenic
929266969 2:39929135-39929157 CTGTGCTTCTGGGGAAAAGCGGG - Intergenic
931061722 2:58536885-58536907 CTGTTTTAGTGGAGAAAAGCAGG + Intergenic
931755975 2:65374928-65374950 CTGGGAGAGGGGAGAGAAGCGGG + Intronic
933166924 2:79086791-79086813 ATGTGAGTGAGGAGAGCAGCAGG - Exonic
933176839 2:79183881-79183903 CAGTGATTGGGGGGAGAAGGAGG - Intergenic
933321153 2:80777267-80777289 CTGAGGAGGTGGAGAGAAGCTGG + Intergenic
934949305 2:98565578-98565600 CTGAGACTGGGGAGAGTAGCAGG + Intronic
934990174 2:98915020-98915042 CTGTGACTGTGAACAGAGGCTGG - Intronic
935263713 2:101376668-101376690 CTGTGAGTCTTGTGAGAAGCTGG - Intronic
937109169 2:119349626-119349648 GAGGGATTTTGGAGAGAAGCTGG - Intronic
937712559 2:124995145-124995167 CTGTGCTTTTGGAGAGATGATGG - Intergenic
938783546 2:134606415-134606437 CTTTGATTGTGGCGAGATGAAGG - Intronic
940180884 2:150931575-150931597 CTGTGACTGTGGATAGATACAGG - Intergenic
940635272 2:156291696-156291718 CCTTGATGGTGGAGAGAAGGAGG - Intergenic
942326076 2:174778239-174778261 GTGGGATTCTGGAGAAAAGCCGG - Intergenic
944990471 2:205229881-205229903 CTCTGCTTGTGGAAAGAAGAGGG - Intronic
946025242 2:216667990-216668012 CTGAGATTGGGGAGAGGAGCGGG + Intergenic
946088047 2:217194478-217194500 CTGTGAGTGTGGATTGAACCAGG + Intergenic
946600544 2:221355597-221355619 CTGTTATTCAGGAAAGAAGCTGG - Intergenic
946889897 2:224264443-224264465 GTGTGTTTGGGGAGAGGAGCTGG + Intergenic
948493937 2:238333171-238333193 CTGTCATTTTGGGGAGAAGGGGG + Intronic
949061397 2:241960020-241960042 TGGTGTTTGTGGAGAAAAGCTGG - Intergenic
1170499091 20:16956289-16956311 CTGTGACTTTGCAGAGAAACAGG + Intergenic
1171111361 20:22485559-22485581 CTTTGATTCTGGAGAGAGCCTGG + Intergenic
1173825103 20:46043183-46043205 GCGTGATTGTGGAGAGGAGTGGG + Exonic
1174503371 20:51001546-51001568 CTGGGGTTGTGCAGGGAAGCCGG - Intergenic
1174628592 20:51936589-51936611 ATGTCACTGTGGAGAGCAGCTGG + Intergenic
1174890077 20:54382552-54382574 CTGTGACTGTGTAGAGTACCTGG - Intergenic
1175683451 20:61008671-61008693 CTGGGAGGGTGGAGAGAAGATGG - Intergenic
1175784937 20:61706414-61706436 ATGTTATTGTTGAGAGAAGGGGG - Intronic
1178635544 21:34299086-34299108 ATGTGATTGAGGAGAGAGGGAGG - Intergenic
1178827635 21:36029990-36030012 CTGTCAGTGTGATGAGAAGCGGG + Intergenic
1179106318 21:38403797-38403819 CTGTGCTTGTGGAAGGCAGCTGG - Intronic
1179323321 21:40314458-40314480 CAGTGCTGGTGGAGAGAATCGGG + Intronic
1180002267 21:45000630-45000652 GAGTGAATGTGGAGAGATGCTGG + Intergenic
1180594815 22:16966184-16966206 CTGTGAGTGGGGAGCCAAGCAGG + Exonic
1182078653 22:27512824-27512846 GTGTGAATCTGGAGAGAAACAGG + Intergenic
1182505805 22:30781489-30781511 GTGTGTTTGTGGAGAGACGCAGG + Intronic
1182586607 22:31347111-31347133 CTGTGGTTTGGGGGAGAAGCTGG - Intergenic
1183924275 22:41194873-41194895 CTGTGAAAGGGAAGAGAAGCCGG - Intergenic
1184268003 22:43360301-43360323 CTGTGGGTGGGGAGTGAAGCGGG + Intergenic
949563909 3:5227963-5227985 CTGTGAGTGCTGAGAGACGCTGG - Intergenic
950017028 3:9761585-9761607 CTGTGATGGTGGGGGGAACCAGG - Intronic
950752883 3:15144834-15144856 CTGTGTTTAAGGTGAGAAGCGGG + Intergenic
951393312 3:22133805-22133827 CTTTGTTTGTGGAGAAAAGTAGG - Intronic
954782793 3:53073298-53073320 CTGTGGGTGAGGAGAGAACCTGG + Intronic
956260153 3:67330282-67330304 CTGTGAGGGTCGAGGGAAGCAGG - Intergenic
956843398 3:73160522-73160544 CTGTGATTCTGCAGACAATCAGG - Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
958801023 3:98756028-98756050 GTGTATGTGTGGAGAGAAGCTGG + Intronic
961285428 3:125798554-125798576 CTGTGTTTAAGGTGAGAAGCGGG + Intergenic
961486004 3:127217000-127217022 CCGGGATGGTGGAGAGAAGGCGG - Intergenic
964091830 3:152886310-152886332 CTGTGTTGGAGGAGAGAAGGTGG + Intergenic
966990944 3:185229465-185229487 CAGTGAGTCTGGGGAGAAGCTGG + Exonic
967711224 3:192710717-192710739 CTGGGATTGTGGAGAGCAGTTGG - Intronic
968577165 4:1372895-1372917 CAGTGAGTGTGTAGAGACGCGGG - Intronic
971938375 4:33183699-33183721 ATGAGATTGTGGGGAGAAGCAGG - Intergenic
972359656 4:38315208-38315230 CTGTGCGTGAGGAGAGAGGCTGG + Intergenic
975695026 4:77004022-77004044 ATATGATGATGGAGAGAAGCAGG - Intronic
975986931 4:80208676-80208698 CTGGGATTGGGGTGAGAAGGTGG + Intergenic
978035645 4:103990114-103990136 CTGTGAATGTGCAGAGAAAAGGG - Intergenic
978228322 4:106366011-106366033 CTGTGAATAAGGAGAGGAGCTGG - Intergenic
978654314 4:111048611-111048633 CTCTGCTTGAGGAGAGAAGAAGG + Intergenic
979210869 4:118100393-118100415 ATGTGGTTGTGGAGGCAAGCTGG - Intronic
979683143 4:123483280-123483302 CTGTGAGAGTTTAGAGAAGCAGG - Intergenic
979851343 4:125574166-125574188 CTATGCTTGAGGAGAGAAGAAGG - Intergenic
980591316 4:134893042-134893064 CTGTGACTCAGAAGAGAAGCTGG - Intergenic
981196678 4:141929175-141929197 CTGTGATGGAGGAGAGAGTCTGG - Intergenic
981596952 4:146435350-146435372 CTGGCCATGTGGAGAGAAGCAGG - Intronic
984704902 4:182840470-182840492 GGGTGATTCTGGTGAGAAGCTGG - Intergenic
985335455 4:188887966-188887988 GTGAGATTGTTGTGAGAAGCAGG - Intergenic
986659487 5:10046215-10046237 TTGTGATGGTGGAGAAAAGGAGG - Intergenic
988446194 5:31288694-31288716 CTGGGATTGAGGAAAGAAACAGG - Intronic
988618953 5:32802869-32802891 CTGTAAATGTGCAGAGAAGATGG + Intergenic
989099487 5:37810914-37810936 CCGTGAGTGTGGAGTGAAGTAGG - Intergenic
996325236 5:122265806-122265828 CTGTGATTATGTAGAGCAACAGG - Intergenic
997668019 5:135647931-135647953 CTGTGGTTGTAGAGAGAGGAAGG + Intergenic
997863491 5:137441087-137441109 CTGTGATTCTGGATAGAAATAGG + Intronic
999661916 5:153873650-153873672 CTGTGATTCTGGAGAGATTCTGG + Intergenic
1000126925 5:158254530-158254552 CTGAGACTGTGGAGAGAAGCTGG + Intergenic
1000540012 5:162527956-162527978 CTGTTATTGTGGAGAGAGGAAGG + Intergenic
1000571817 5:162924191-162924213 GTGTGTTTGTGGAGGGAAGGAGG + Intergenic
1001064780 5:168527922-168527944 ATGTGATTGTGGAGACCAGCAGG + Intergenic
1001271958 5:170319560-170319582 TTGTGATTGTGGAGCACAGCAGG - Intergenic
1003117471 6:3292903-3292925 CTCTGTTGGTGAAGAGAAGCTGG - Intronic
1003192648 6:3888088-3888110 CTGTGATTGTGCAGAGCAACAGG + Intergenic
1003968689 6:11278076-11278098 CTGAGGCTGTGGAGAGAAGCAGG - Intronic
1004247172 6:13990087-13990109 CTGTGACTCTGGAGAGGACCAGG - Intergenic
1005445871 6:25922455-25922477 ATGTGAGTGTGCTGAGAAGCAGG + Intronic
1005486159 6:26301897-26301919 CAGTGGCTGGGGAGAGAAGCAGG - Intergenic
1008029786 6:46681531-46681553 CTGTGATTGTCAACAGCAGCAGG + Intergenic
1008405690 6:51116361-51116383 CTGAGATTCAGGTGAGAAGCAGG - Intergenic
1009439404 6:63658812-63658834 ATGTGATTGTGGAGACTGGCTGG + Intronic
1009890925 6:69680876-69680898 CTGTGATTCAGGTGAGCAGCTGG - Intronic
1011827098 6:91320888-91320910 CTGTAATTGTGGAGAAATCCTGG + Intergenic
1012797596 6:103782324-103782346 CTGTAATTGTGGAGATATTCTGG - Intergenic
1017661916 6:156683351-156683373 CTTTGAGTGTGGAGAGAAGAGGG - Intergenic
1018923500 6:168191465-168191487 CTGGGCTTGTGGAGAGAAATGGG + Intergenic
1019684816 7:2375549-2375571 TTTTGACTGTGGATAGAAGCAGG + Intronic
1020052142 7:5088679-5088701 CTGTTCTTCTGGAGAGAGGCGGG - Intergenic
1022729363 7:33008114-33008136 CTGTGATGGTGGAGACAGACGGG + Intergenic
1023591339 7:41783635-41783657 CTGTAGATGTGGAGAGAAGACGG + Intergenic
1023929435 7:44696338-44696360 ACGTGATTTTGGGGAGAAGCAGG - Intronic
1025928763 7:65979286-65979308 CTGTGAGGGTGTAGAGATGCTGG + Intronic
1026150956 7:67787812-67787834 CTGTTATTGAGCAAAGAAGCAGG - Intergenic
1026230994 7:68484056-68484078 CTGGGATACTTGAGAGAAGCTGG + Intergenic
1030021007 7:105275195-105275217 CTTTCCTTGTGGAGAGCAGCAGG + Intronic
1030898831 7:115096558-115096580 CTGAGAATGTGGAAAGAAGCTGG - Intergenic
1031306211 7:120130725-120130747 CTCTGCTTGAGGAGAGAAGAGGG + Intergenic
1031475526 7:122216529-122216551 ATTTCACTGTGGAGAGAAGCAGG + Intergenic
1032936874 7:136743124-136743146 CTGTCACTGAGGAGAAAAGCAGG + Intergenic
1033733475 7:144200230-144200252 ATCTGATTGAGGAGAGAAACAGG + Intergenic
1033749575 7:144350743-144350765 ATCTGATTGAGGAGAGAAACAGG - Intergenic
1034358906 7:150477104-150477126 TTGTCCTTGTGGGGAGAAGCGGG + Exonic
1035016911 7:155774662-155774684 CTGTGCTTGTGGTGATAAGGGGG + Intronic
1035390804 7:158503332-158503354 CTGTGAGGGTAGAGAGAAGCTGG - Intronic
1036285662 8:7442510-7442532 CTATGTTTGTGGAAAGAAGGAGG - Intergenic
1036335811 8:7869019-7869041 CTATGTTTGTGGAAAGAAGGAGG + Intergenic
1037843341 8:22261311-22261333 CTGAGATTGCTGAGGGAAGCAGG - Intergenic
1037916620 8:22777062-22777084 AGGTGAGTGTGCAGAGAAGCAGG + Intronic
1038586590 8:28795252-28795274 CTGTGATGGTACAGAGAGGCAGG + Intronic
1039379006 8:37067503-37067525 CTGGGATTGTGGTGAGGATCTGG + Intergenic
1039821396 8:41138472-41138494 CAGTGATACAGGAGAGAAGCTGG - Intergenic
1040602435 8:48897741-48897763 CAGTGATTCTGGAGGGAGGCAGG - Intergenic
1040800989 8:51339533-51339555 CTGTAATTGTGGAGAGTTACTGG + Intronic
1041508865 8:58632524-58632546 CAGTGAGGTTGGAGAGAAGCAGG - Intronic
1041725887 8:61017066-61017088 CTGTCTTTTTGGAGAGAAGCAGG - Intergenic
1042572814 8:70185059-70185081 CTGTGTCTGTAGAGAGAAACTGG - Intronic
1044419307 8:91974509-91974531 TTGTGATTTTGGACAGAAGAAGG - Intronic
1044627892 8:94252151-94252173 CTGTGATTGAGTAGACAATCAGG + Exonic
1046351822 8:113025319-113025341 CTTTGATTCTGGGTAGAAGCAGG + Intronic
1048575247 8:135685032-135685054 CAGTGGCTGTGGAGAGAACCGGG - Intergenic
1050820917 9:9878869-9878891 GTTTGATTGTGGAGGGAAGGAGG - Intronic
1052402012 9:28012265-28012287 ATGTGAAGGTGGAGAGGAGCTGG + Intronic
1052715927 9:32117074-32117096 ATGTGCATGTGGAGAGAAGATGG - Intergenic
1053238829 9:36479459-36479481 ATGTGGGGGTGGAGAGAAGCAGG + Intronic
1055758664 9:79582864-79582886 CTGGGCTGTTGGAGAGAAGCAGG + Intronic
1056516715 9:87359180-87359202 CTCTGCTTGAGGAGAGAAGAGGG + Intergenic
1056902120 9:90609499-90609521 CTGGGGTTGTGGAGGAAAGCAGG + Intergenic
1057064487 9:92036108-92036130 CTGTGATGATGCACAGAAGCGGG + Intronic
1058576698 9:106411404-106411426 CTGAGATTGTATAGAAAAGCAGG - Intergenic
1059417976 9:114173761-114173783 CTGTGATTGTGGACTGATGGTGG + Intronic
1059677974 9:116558189-116558211 CTGTGATGTTGCAGACAAGCTGG + Intronic
1059715146 9:116906403-116906425 CTGTGCTTTTCGGGAGAAGCAGG + Intronic
1059720907 9:116959361-116959383 ATGTGACTGGAGAGAGAAGCAGG + Intronic
1060101778 9:120847057-120847079 CTCTGGGTGAGGAGAGAAGCAGG - Intergenic
1061246329 9:129402828-129402850 ATGGGATGGGGGAGAGAAGCTGG - Intergenic
1187500181 X:19832908-19832930 CAGTGACTGTGGAGGGAACCAGG - Intronic
1188592758 X:31859218-31859240 CTGCCATTTTGGAGAGGAGCAGG + Intronic
1190047342 X:47123272-47123294 CAGTGATTGTGGAGGGCAGGGGG + Intergenic
1190727771 X:53201815-53201837 GTGGGATGGTGGGGAGAAGCAGG - Intronic
1190783695 X:53623137-53623159 CTGGGATAGTGGTGAGGAGCAGG - Intronic
1193236667 X:79114824-79114846 CTGAGACTGTGTAAAGAAGCAGG + Intergenic
1194181421 X:90715607-90715629 CTGTCACTGTGGGGATAAGCAGG - Intergenic
1195079566 X:101358166-101358188 CTGTGATACTGGGTAGAAGCTGG - Intronic
1195750535 X:108159046-108159068 CTGGGAGGGTGGAGAGAAGAGGG + Intronic
1198773927 X:140159579-140159601 CTGTAATGATGGAGGGAAGCTGG + Intergenic
1199982676 X:152929385-152929407 CAGGGACTGGGGAGAGAAGCGGG + Intronic
1200528045 Y:4297523-4297545 CTGTCACTGTGGGGATAAGCAGG - Intergenic