ID: 1132556971

View in Genome Browser
Species Human (GRCh38)
Location 16:576812-576834
Sequence CTGAAGGCCCAGAGGCAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 606
Summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 560}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132556971_1132556978 26 Left 1132556971 16:576812-576834 CCATGCTGCCTCTGGGCCTTCAG 0: 1
1: 0
2: 4
3: 41
4: 560
Right 1132556978 16:576861-576883 AAAGCCCCGTCTCTTCCATTAGG 0: 1
1: 0
2: 1
3: 8
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132556971 Original CRISPR CTGAAGGCCCAGAGGCAGCA TGG (reversed) Intronic
900337853 1:2173655-2173677 CCGACAGCCCAGAGGCAGCCTGG + Intronic
900567072 1:3338729-3338751 CTGGAGCCCCAGAGGCAGCCAGG + Intronic
900836042 1:5004888-5004910 CTCTAGGCCCAGAAGAAGCATGG - Intergenic
900972849 1:6001042-6001064 CCAAAGGCGCAGAGACAGCATGG + Intronic
902137520 1:14322953-14322975 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
902263628 1:15246089-15246111 CGGAAGGCCAAGGGGAAGCAAGG + Intergenic
902782472 1:18713305-18713327 CAGTAGGACCACAGGCAGCATGG + Intronic
902825832 1:18973595-18973617 CAGGAGGCACGGAGGCAGCACGG - Intergenic
902919722 1:19658510-19658532 AGCGAGGCCCAGAGGCAGCAGGG + Intergenic
903047401 1:20575149-20575171 GCAAAGGCCCCGAGGCAGCAAGG + Intergenic
903759146 1:25685554-25685576 CTGAAGGTCCTGGGGCAGCTGGG + Intronic
903766999 1:25741457-25741479 CTGAAGGCCAAGATCCAGTAAGG + Intronic
904773281 1:32893001-32893023 CTGGAGGGCCAGAGGCAGCTGGG - Intronic
905298109 1:36967430-36967452 CTCATGGCCCTGAGGGAGCATGG + Intronic
905688629 1:39926755-39926777 ACGAAGGCCCAGAGGCAAGAAGG - Intergenic
906188286 1:43878559-43878581 GTCAAGGCCCTAAGGCAGCAAGG + Intronic
906243454 1:44256904-44256926 CTGCAGGGACTGAGGCAGCATGG - Intronic
907270526 1:53288382-53288404 CTGAAGGCTCCCAGGCAGGAGGG - Intronic
907383987 1:54113929-54113951 ATGACTGCCCAGGGGCAGCAGGG + Intergenic
907384288 1:54115966-54115988 ATGACTGCCCAGGGGCAGCAGGG + Intergenic
907399708 1:54217375-54217397 CTGAAGACACAGAGTCAGGAGGG - Intronic
909017996 1:70400217-70400239 ATGAAAGGCCAGAGGCAGAAGGG + Intergenic
909501178 1:76337301-76337323 CTGCTGGCCCAGAGGCAAGAGGG + Intronic
909669636 1:78173605-78173627 TAGAAGGCACAGAGGCAGAATGG - Intergenic
910493163 1:87795392-87795414 CTGGAGGCTCAGAACCAGCAAGG - Intergenic
911196310 1:94998673-94998695 CTGAAGGCCAAGTGGCAGACAGG - Intronic
911709836 1:101057827-101057849 CAGAATGCAAAGAGGCAGCAAGG - Intergenic
912600289 1:110924453-110924475 CAGAGGGCAAAGAGGCAGCAAGG + Intergenic
912603391 1:110963222-110963244 CTGAAGGTCCAGCGCCACCAGGG + Intronic
913167294 1:116200026-116200048 CTGTTGTCCCATAGGCAGCATGG - Intergenic
913398423 1:118398693-118398715 CGGAAGGCAAAGAGGAAGCAAGG - Intergenic
913699728 1:121362641-121362663 GAGATGGCCCAGAGGCAGGAGGG + Intronic
914943139 1:152040182-152040204 CTGAAGGGCTGGAGCCAGCAAGG + Intronic
915340697 1:155175163-155175185 CTAAAGGCCCAGAGGAGGGACGG - Intronic
915488496 1:156238717-156238739 CTGAAGGCCCTGCTGCAGCTTGG + Intronic
915574701 1:156767917-156767939 CTGAGGGGGCGGAGGCAGCAAGG - Exonic
916189697 1:162166998-162167020 CAGAATACCCAGAGGCAGCAGGG - Intronic
916555768 1:165892966-165892988 ATGAAGGGCCATAGGCGGCAGGG + Intronic
917662191 1:177187547-177187569 ATGAAGCCCCAGAAGCTGCAAGG - Intronic
918130024 1:181619347-181619369 GTGAAGGCCCTGAGGAAGGAGGG + Intronic
918239005 1:182605417-182605439 CTGAAGACCCAGCTGCAGGAAGG + Intergenic
919159450 1:193809094-193809116 CTGAAGGCAAAGGGGAAGCAAGG + Intergenic
919795234 1:201317692-201317714 CTGGAGACCCGGAGGCAGAATGG + Exonic
919935980 1:202251392-202251414 ATGAAGGCTCAGGGGCTGCAGGG - Intronic
919944903 1:202311953-202311975 CTGCTGGCCCAGAGCCAGCCAGG - Intronic
920336373 1:205247938-205247960 CTCAAGCCCCAAAGGGAGCAGGG + Intronic
921095781 1:211886238-211886260 CTCAAGCACCAGGGGCAGCAAGG - Intergenic
921188004 1:212686252-212686274 CTGAAGGCCTAGAAGTGGCAAGG + Intergenic
922569840 1:226627946-226627968 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
922820120 1:228479020-228479042 CTGCAGGGCCAGAGACAGCATGG - Intergenic
922949146 1:229543744-229543766 ATAAAGGCCCTGAGGCAGAAAGG + Intronic
923009541 1:230077192-230077214 GGAAAGCCCCAGAGGCAGCAAGG - Intronic
1063666088 10:8061586-8061608 GTGACAGACCAGAGGCAGCAAGG + Intronic
1064566086 10:16640630-16640652 GCGAAGGCCCTGTGGCAGCAGGG - Intronic
1065450853 10:25855465-25855487 CTGATGAGCCAGAGACAGCAGGG + Intergenic
1065866724 10:29921051-29921073 GTGAAGTCCCCCAGGCAGCAGGG + Intergenic
1066503923 10:36022425-36022447 GAAAAGGCCCAGATGCAGCAAGG + Intergenic
1067342941 10:45419212-45419234 GTGAAGGCGCAGAGGCAGGGAGG + Intronic
1067405657 10:46021393-46021415 CTGAAGGGCCACAGCCAGAAGGG + Intronic
1067714932 10:48683590-48683612 GTGAATGCCCAGAGGAAGCGCGG - Intergenic
1068313142 10:55305407-55305429 CTGATGGCTCAGAGGCAGAGAGG + Intronic
1068381928 10:56265409-56265431 CAGAAGGCCAAGAAGAAGCAAGG + Intergenic
1069267077 10:66473398-66473420 CAGAAGGCAAAGGGGCAGCAAGG - Intronic
1069923787 10:71834066-71834088 ACAGAGGCCCAGAGGCAGCATGG + Intronic
1071113644 10:82191896-82191918 CCGCAGGGCCAGAGGCAGCTAGG - Intronic
1072309889 10:94144712-94144734 GCAAAGGCCCAGTGGCAGCAGGG + Intronic
1072895051 10:99359562-99359584 GTGAAGGCCCAGAGTCAGAGCGG + Intronic
1072919436 10:99563556-99563578 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
1073939119 10:108673506-108673528 CTGAAGGCATAAAGCCAGCAAGG - Intergenic
1075315876 10:121453063-121453085 ATGAAGGCTCAGAAGAAGCAGGG + Intergenic
1075726391 10:124612965-124612987 CTGGAGGCCCAGAGGGAGCTGGG + Intronic
1076167587 10:128294774-128294796 CACATGGCCCAGAGGCAGCCTGG - Intergenic
1076202183 10:128567631-128567653 CTCAGGGCCTGGAGGCAGCATGG - Intergenic
1076393313 10:130120140-130120162 CAGAAGGCCAAGGGGCAGCGGGG + Intergenic
1076395350 10:130134866-130134888 CTCAAAGCCCAGGGACAGCAGGG + Intergenic
1076721251 10:132394314-132394336 CTGTAGGCACAGCCGCAGCAAGG - Intergenic
1076729015 10:132429181-132429203 CCGAGGGGCCAGTGGCAGCAGGG + Intergenic
1076867994 10:133178648-133178670 CAGGAGGCACAGAGGCAGCCAGG - Intronic
1076930527 10:133528923-133528945 CTGCGGGCCCAGAGGCGGAACGG - Intronic
1076976960 11:180265-180287 CTGAAGTGCCAGAAGCAGCGAGG - Intronic
1077791254 11:5442477-5442499 CTGAAGGAAAAGAGGCAGAAAGG - Intronic
1078083024 11:8217688-8217710 CTGAAAGCCCAGGTGAAGCAGGG + Intergenic
1078260574 11:9703407-9703429 CTGAAGGCTCTGAGGCAGGAAGG - Intronic
1078518653 11:12046443-12046465 CGGAAGGCGAAGAGGAAGCAAGG - Intergenic
1078674195 11:13394403-13394425 CAGAAGGCAAAGAGGAAGCAAGG - Intronic
1079881728 11:25936344-25936366 CTGAAGGCAAAGGGGAAGCAAGG - Intergenic
1080006810 11:27417024-27417046 CAGAAGGCCCAGACCCAGTAAGG - Intronic
1082273094 11:50193179-50193201 CTGAAGGATCAGAGGAAGAAAGG + Intergenic
1083144227 11:60746705-60746727 CTGTAGGCCCAGACTAAGCAAGG - Intergenic
1083430414 11:62611369-62611391 CTGAAGCCCCAGAGGCCCCAAGG + Intronic
1083669773 11:64293115-64293137 CAGCAGGCCCAGAGGGAGCTGGG + Exonic
1083800141 11:65041752-65041774 CTGCAGGCCCAGGTGCAGGAGGG + Exonic
1084886281 11:72209354-72209376 CTGAAGGCTAAGGGGAAGCAAGG - Intergenic
1085310403 11:75513302-75513324 CTTAAGGCACACAGCCAGCAAGG + Intronic
1085477887 11:76799219-76799241 GTGAAGGCCCAGTGAGAGCATGG + Intergenic
1085782224 11:79419822-79419844 CTGAAGGCCCAGAGAAGGGAAGG - Intronic
1088415223 11:109581234-109581256 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
1088729377 11:112667396-112667418 GTGTAGGTCCAGAGGCTGCAAGG - Intergenic
1088847786 11:113682330-113682352 CTGCAGGCCCTGAGGAAGGAGGG + Intergenic
1089150045 11:116357365-116357387 CTGATGGCTGAGAGGGAGCAGGG - Intergenic
1089362873 11:117902545-117902567 CTGAAGGCCCAGAGAAGGCAGGG + Intronic
1089376371 11:117997952-117997974 GCAAAGGCCCTGAGGCAGCACGG + Intronic
1089455332 11:118622458-118622480 TTTATAGCCCAGAGGCAGCATGG + Intronic
1089505865 11:118961524-118961546 CTGAAGGTGCAGAGACACCAGGG + Intergenic
1089586544 11:119513183-119513205 CTGGAGGCACAGAGACACCAGGG - Intergenic
1089637663 11:119826510-119826532 CTGGGTGCCCAGAGGCAACATGG + Intergenic
1090087107 11:123660105-123660127 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
1091152305 11:133340165-133340187 GACAAGGCCCAGGGGCAGCAGGG - Intronic
1091243206 11:134069050-134069072 CTGAGGGGCCAGCGGCAGCGCGG - Exonic
1091694924 12:2622066-2622088 CTGGAGGCCAAGAGCCAGGAAGG + Intronic
1092139423 12:6172506-6172528 CTGAAGTTCCAGAGGGAGGAAGG + Intergenic
1092347259 12:7725967-7725989 CTGAAGTCAGGGAGGCAGCAGGG - Intergenic
1092457676 12:8658686-8658708 CTGAAATCCCAGAGACAGCTAGG - Intronic
1092950741 12:13500683-13500705 CCAAAGGCACAGAGTCAGCAGGG - Intergenic
1092981893 12:13803878-13803900 CTGCAGGCTCACAGGCAGAAAGG - Intronic
1093350918 12:18102676-18102698 TTGCAGGCTCAGAGGCAGAAGGG - Intronic
1094090680 12:26645592-26645614 TTGAATGCCCAGAGGCAGCATGG + Intronic
1094797931 12:33998085-33998107 CTGAAGGGCCAGAGTCAGCAAGG + Intergenic
1095110697 12:38292124-38292146 CTGAAAGGCCAGAGTCAGCAAGG + Intergenic
1096199111 12:49668629-49668651 CTGAGGGCCCAGTAGCAGAAAGG - Intronic
1096652291 12:53067832-53067854 CTGAAGCCCCAGTGCCTGCAGGG - Intronic
1097261481 12:57722867-57722889 CAGATGGACCAGAGGAAGCAGGG - Intergenic
1097311247 12:58121868-58121890 GTGAAGGCCCAGAGGCCAAAGGG + Intergenic
1097981292 12:65740573-65740595 GTGAAGCCCCACAGGCTGCAAGG - Intergenic
1098448354 12:70590813-70590835 GCAAAGGCCCAGAGGCAGAAGGG - Intronic
1098764804 12:74472457-74472479 CTGAGAGCCCAGAGGAAACAAGG + Intergenic
1099314067 12:81063101-81063123 CAGAAGGCAAAGAGGAAGCAAGG + Intronic
1100268356 12:93000046-93000068 CTGATGGGCCAGAGACAGGAGGG - Intergenic
1100359252 12:93861152-93861174 CTGAGGGAGCAGAGGCTGCAGGG + Intronic
1100594418 12:96059558-96059580 CTGAAGGCCCAGTGTTAGCATGG - Intergenic
1100715584 12:97302004-97302026 CTGAAAGCCCAGAGGAGGCAGGG - Intergenic
1100874916 12:98951669-98951691 CTGTAGGCCCAGAGGGAAGAGGG - Intronic
1101658323 12:106743834-106743856 CTGAGGTCCCAGAGGCTTCAAGG + Intronic
1102581348 12:113890252-113890274 CTCACGGCCCAGAGCCAGCCTGG - Intronic
1102907333 12:116687131-116687153 CGGAAGGCCCAGCGTCAGCCTGG + Intergenic
1102998664 12:117368510-117368532 GTTAAGGCCCAGAGGGAGGAGGG - Intronic
1103156409 12:118688912-118688934 GTGAAGGCCCAGAGTCAAAAGGG + Intergenic
1103173612 12:118843508-118843530 TGGAAGGGCCTGAGGCAGCAGGG - Intergenic
1103567936 12:121826487-121826509 GCAAAGGCCCTGAGGCAGCAGGG + Intronic
1103955445 12:124573961-124573983 CTGAAGGAGCAGAGGAAGCCGGG - Intergenic
1103958901 12:124595151-124595173 CTCCAGGCCCAGAGTCAGAAGGG + Intergenic
1104423267 12:128654372-128654394 CTGCAGCCTCAGAGGGAGCACGG + Intronic
1104528466 12:129547072-129547094 CTAGAGCCCCAGAGGAAGCAAGG - Intronic
1105245603 13:18647194-18647216 CTGCAGGCCCAGAGGATTCAGGG - Intergenic
1105529081 13:21201940-21201962 CAGAAGGCAAAGAGGAAGCAGGG + Intergenic
1106225063 13:27779240-27779262 CTCAAGGCCCAGATGCCACAGGG + Intergenic
1106910341 13:34456422-34456444 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
1107343418 13:39434087-39434109 TTGCATGCTCAGAGGCAGCATGG + Intronic
1107553316 13:41496570-41496592 CTCTATGCCCAGAGGCTGCAGGG + Intergenic
1109502004 13:63249951-63249973 CTGAAGGCCCACAGGCACTGGGG + Intergenic
1112504249 13:99966048-99966070 CTGCAGTCCCAGAGGGATCAGGG + Intronic
1112579423 13:100665539-100665561 GTGGGGGCCCAGAGGCAGCCAGG - Intronic
1112660885 13:101506454-101506476 CTGAAAGACCACATGCAGCAAGG + Intronic
1113107674 13:106789043-106789065 ATAAAGCCCCAGAGGCAGGATGG + Intergenic
1113580686 13:111426501-111426523 CTGAAGTCACAGAGGCAGTGAGG - Intergenic
1113743892 13:112729422-112729444 CAGAAGGCACTGAGGCAGCGCGG + Intronic
1113948859 13:114060123-114060145 GCGAAGGCCTCGAGGCAGCAGGG + Intronic
1114489515 14:23090028-23090050 CTGAAAGTCAGGAGGCAGCAGGG + Exonic
1114521320 14:23338992-23339014 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
1114670791 14:24409934-24409956 CTGAAGGGCCAGGGGCAGGCTGG + Exonic
1114764017 14:25350095-25350117 TTTAAAGCCAAGAGGCAGCAGGG - Intergenic
1115572670 14:34681470-34681492 CTGAAGACCCAGAGAAACCAGGG - Intergenic
1118057350 14:62093859-62093881 GTGAAGCCCCTGAGTCAGCAGGG - Intronic
1118590178 14:67395265-67395287 CTGAAGGCCCTGAAGCACCGTGG + Intronic
1119483602 14:74974679-74974701 CTACAGGCCCAGGGGCAGCCTGG - Intergenic
1119721893 14:76897583-76897605 CGGAAGGCCGGGAGGCCGCAGGG - Intergenic
1119754398 14:77104617-77104639 GTGAAGGCCCTAAGGGAGCAAGG - Intronic
1120906677 14:89626750-89626772 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
1121286900 14:92743097-92743119 GTGAAGGCCCAGAGAGAGGAAGG - Intronic
1121457376 14:94047028-94047050 TTGAAGGTCCTGAGGCAGCAAGG - Exonic
1121998709 14:98628032-98628054 CTAAAGTCTCAGAGGGAGCATGG + Intergenic
1122449843 14:101796839-101796861 CTTGAGGAGCAGAGGCAGCAGGG - Intronic
1122451100 14:101808210-101808232 GTGAAGGCTTAGAGGCAGGAGGG + Intronic
1122533157 14:102443163-102443185 ATGGAGGCCCAAAGGCTGCAGGG - Intronic
1124088056 15:26570415-26570437 CGCAAGGCCCAGAGCCAGGAGGG - Intronic
1125225495 15:37390693-37390715 CTGAAGGCAAAGGGGCAGCTAGG + Intergenic
1125311984 15:38389711-38389733 CTGAAGGCCCAGTGTTGGCAAGG + Intergenic
1125612404 15:40980369-40980391 TTGAAGGTCCAAAGTCAGCAAGG + Exonic
1125708706 15:41765645-41765667 ATGAAGCCCTAAAGGCAGCATGG - Intronic
1125727864 15:41877258-41877280 CTGAGGGTCCTGGGGCAGCAGGG - Exonic
1126570406 15:50144450-50144472 CAGAAGGCAAAGAGGAAGCAAGG + Intronic
1126703368 15:51386483-51386505 AGGAGGGACCAGAGGCAGCAGGG + Intronic
1126708005 15:51424864-51424886 CTCAAGGCCCAGGGGCATCATGG - Intergenic
1127796779 15:62445186-62445208 CTGAAGGCCTGGAGTCAGCTGGG - Intronic
1128347149 15:66861501-66861523 CGGAAGGCCCAGAGAAAGCTGGG + Intergenic
1128457345 15:67839056-67839078 CTGAGGTCCCAGTGGCCGCAGGG + Intergenic
1128513413 15:68327287-68327309 CTGAAGGGGAGGAGGCAGCAGGG - Intronic
1128606279 15:69038803-69038825 CTGCAGGCCCAAAGCCACCAGGG - Intronic
1129968538 15:79757813-79757835 CTGGGGGACCAGAGGCAGCACGG + Intergenic
1130192154 15:81747664-81747686 CAGAATGCCAAGAGGAAGCAGGG - Intergenic
1130957685 15:88639055-88639077 CTGAGGGCGCAGAGGCAGGCAGG + Exonic
1131083455 15:89555919-89555941 CTCAGGGCTCAGAGGCTGCAGGG + Intergenic
1131095651 15:89652902-89652924 CTGGAGGCTCAGAGGCTGCCAGG - Exonic
1131165396 15:90138620-90138642 CTGAGTGCCAAGAGGCAGCCTGG - Intergenic
1131271641 15:90950760-90950782 CGACAGGCCAAGAGGCAGCACGG + Intronic
1131761595 15:95628736-95628758 TTGAAGTCCCAGAGAGAGCAAGG + Intergenic
1132090055 15:98940927-98940949 CTGAGAGCCCTGAGGCAGGACGG - Intronic
1132279181 15:100598001-100598023 ATCAAGGCCCAGAGGCTGGAAGG - Intronic
1132502751 16:291860-291882 GTGAAGGCCCAGAGGCAGGTTGG - Intronic
1132556971 16:576812-576834 CTGAAGGCCCAGAGGCAGCATGG - Intronic
1133168522 16:3965549-3965571 CGGATGACCCAGAGGCAGCGGGG + Exonic
1133678694 16:8099864-8099886 CTGAAGGCAAAGGGGTAGCAGGG - Intergenic
1133894856 16:9916899-9916921 TTGAAGGCCAAGAGACACCATGG - Intronic
1134047955 16:11115075-11115097 CTGAAGCCCCTCAGGCAGCCAGG + Intronic
1134332456 16:13263502-13263524 CAGAAGGCAAAGAGGTAGCAGGG - Intergenic
1136172445 16:28497053-28497075 CAGAAGTCCCAGAGGCAGGCGGG + Exonic
1136500007 16:30665334-30665356 CGGGAGGCCCGGAGGCAGCCCGG - Exonic
1137039571 16:35598098-35598120 CTTAAGGCCCAAAGGCAGCCAGG - Intergenic
1137070518 16:35900655-35900677 CTGCAGCCCAGGAGGCAGCACGG - Intergenic
1137612604 16:49828966-49828988 ATGAGGGCCCAGCGGGAGCAGGG - Intronic
1137840056 16:51632474-51632496 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
1138542135 16:57694922-57694944 CTGGAGGCCCCCAGGCAGAAGGG - Intronic
1139311735 16:66033376-66033398 CTGAATGCCCAGTGGCCACAAGG + Intergenic
1139660090 16:68414791-68414813 GGGAAGGCTCAGAGGCAGCAGGG + Intronic
1139660378 16:68416740-68416762 TTGAAGCCCCAGTGGCTGCATGG - Intronic
1139890774 16:70252027-70252049 CTGGAGGCCCGGAGGGAGAACGG + Intergenic
1139939667 16:70596157-70596179 CTGTAGCCTCAGAGGCAGGAGGG + Intronic
1140668272 16:77248066-77248088 CTAAAGTCCAAGAGGGAGCAAGG + Intronic
1141170242 16:81686383-81686405 CGGAAGGCCCAGGTGCAGCCTGG - Intronic
1141749105 16:85946467-85946489 GTGGTGGCCCAGAGGGAGCAGGG - Intergenic
1141842651 16:86584049-86584071 CTGAGGGGGCAGAGGCAGGATGG - Intergenic
1142278670 16:89136720-89136742 CTGTAGGCACAGAGGCAGGTGGG - Intronic
1142443300 16:90116405-90116427 CTGAAGTGCCAGAAGCAGCGAGG + Intergenic
1144083034 17:11781896-11781918 CTGAAGGCACTGAGGCTGGAAGG - Intronic
1144108352 17:12007547-12007569 CTGACTGCCCAAAGTCAGCAGGG - Intergenic
1144273605 17:13643654-13643676 CTGAAGGCACCGGGGCAGCGGGG + Intergenic
1146662069 17:34671378-34671400 CTGCAGCCTCAGAGCCAGCATGG + Intergenic
1146681131 17:34809154-34809176 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
1147738274 17:42654790-42654812 CTTAAGGCCCACAGTCAGAAAGG - Intergenic
1147888196 17:43698621-43698643 TTGAAGGCCGAGAGCCAGGAAGG + Intergenic
1148210478 17:45805649-45805671 CTGAAGCCCAAGAGGCCTCATGG - Intronic
1148866828 17:50633156-50633178 ATGAAGTCCCAGAGGCATCAAGG + Intergenic
1149342995 17:55705921-55705943 CTGAAGGCAAAGGGGAAGCAAGG - Intergenic
1149926149 17:60704127-60704149 CTGCCGACCAAGAGGCAGCAGGG + Intronic
1150011476 17:61508594-61508616 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
1150289380 17:63972797-63972819 CTCAGGGCCCAGAGGCACCAGGG + Exonic
1150335473 17:64327500-64327522 CTGGAGGCCAGGAGGCAGCTGGG - Intronic
1150843919 17:68635402-68635424 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
1151403492 17:73871659-73871681 CTGCAGGCTCAGGTGCAGCAGGG - Intergenic
1151549229 17:74812295-74812317 CTGAAGGACCACAGGCTTCAGGG - Intronic
1151628849 17:75296141-75296163 GTGGAGGTGCAGAGGCAGCAAGG - Intergenic
1151928826 17:77217872-77217894 CTGACGGCCCAGGCCCAGCATGG - Intergenic
1151966535 17:77434467-77434489 CTGCAGACTCAGAGGCAGTACGG - Intronic
1152098391 17:78286461-78286483 CTGAAAGCCCAGGGGAGGCAGGG - Intergenic
1152170857 17:78747204-78747226 CTGAAGGCCCAGAGTATGCCAGG + Intronic
1152261015 17:79267201-79267223 CACAGGGCCCAGAGCCAGCAAGG - Intronic
1152392327 17:80010211-80010233 CTGATGGGCGAGAGGCAGAAGGG + Exonic
1152400903 17:80065610-80065632 CTGCAGGGCCACAGGCAGCGAGG + Intronic
1152734564 17:81991123-81991145 CTGAAGACCGTGAGGGAGCAGGG + Intronic
1152859879 17:82690162-82690184 CTGAAGAATCAGAGGGAGCATGG + Intronic
1152920021 17:83061984-83062006 CAGAAGGCCCGGAGGGTGCACGG + Intergenic
1154104237 18:11506280-11506302 CTGAAGCCCCTGACGCAGCTGGG - Intergenic
1154443343 18:14412736-14412758 CTGCAGGCCCAGAGGATTCAGGG + Intergenic
1155101023 18:22609857-22609879 CTGACGGATGAGAGGCAGCAGGG + Intergenic
1156160295 18:34350944-34350966 CAGGAGGGGCAGAGGCAGCAGGG - Intergenic
1156486828 18:37471713-37471735 GGGAAGCCCCAGGGGCAGCAGGG + Intronic
1156524963 18:37758275-37758297 CTGAAGGCAAAGGGGGAGCAGGG + Intergenic
1157227551 18:45880674-45880696 ACCAAGACCCAGAGGCAGCATGG + Intronic
1157303482 18:46498232-46498254 CTGAGAGCCTAGAGTCAGCAGGG - Intronic
1157328581 18:46686631-46686653 CTGATGGCCCCAGGGCAGCATGG - Intronic
1157718828 18:49907878-49907900 CTGAAGGCCCAGTGGGTGCATGG - Intronic
1157946329 18:51984723-51984745 CTGAAGGCAAAGGGGAAGCAGGG + Intergenic
1158668880 18:59456818-59456840 GAGCAGGCCCAGAGGCAGCCTGG + Intronic
1159265630 18:66074762-66074784 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
1159583423 18:70260749-70260771 CTGCAGGTCCACAGGCAGGAAGG + Intergenic
1159887071 18:73918941-73918963 CTGCAGGCCCAGATACTGCAGGG - Intergenic
1160385924 18:78496234-78496256 CTGAAGGGCCAGATACAGCCTGG - Intergenic
1160411553 18:78678506-78678528 CTGGAGCCCCAGAGGGGGCAGGG - Intergenic
1160710758 19:549951-549973 CGGAAGCCCCACAGCCAGCATGG - Intergenic
1161005281 19:1932651-1932673 AGGATGGCCCAGAGGCAGCCAGG - Intergenic
1161195382 19:2983535-2983557 GTGAAGGCCCTGAGGCAGGACGG + Intronic
1161399670 19:4061671-4061693 TTAAAGGGCCAGAGGCAGGAAGG + Intronic
1161646307 19:5455515-5455537 CTTAATGCCTAGAGCCAGCAGGG + Exonic
1162086743 19:8253980-8254002 TTGGAGGCCCAGAGTCAGAAAGG - Intronic
1162183653 19:8888165-8888187 CTCAAGCCCCACATGCAGCAAGG - Intronic
1162189706 19:8935245-8935267 TGGAAAGCCCAGAGACAGCAGGG + Exonic
1162342986 19:10102920-10102942 CTGCAGGCCCTGGGGCAGCCAGG + Intergenic
1162373696 19:10293130-10293152 CAGCAGGCCCAGAGCCAGCACGG - Exonic
1163421770 19:17217522-17217544 ATGGAGGCCCCGGGGCAGCAAGG - Intronic
1163528579 19:17836169-17836191 CTGTATGAACAGAGGCAGCAGGG - Intronic
1163587571 19:18172512-18172534 CTGAAGTCCCAGTGGCTGGATGG - Intronic
1164156621 19:22601316-22601338 TTGAAGGCACAGAGGCTGCCAGG - Intergenic
1164616230 19:29668276-29668298 CTCAGGGCCCAGAGGCTGCCAGG + Intronic
1164840912 19:31391415-31391437 GTGAAGGGCCAGAAGCAGAATGG + Intergenic
1165106052 19:33470213-33470235 CTGGAGGCCTAGAGGCTGGAGGG - Intronic
1165424629 19:35739087-35739109 CTGGTGGCCCAGAGGCACCTGGG + Exonic
1165473126 19:36014768-36014790 CTGAAGGCCCAGGGGGTCCAGGG - Exonic
1165474613 19:36023354-36023376 ATGGAGACCCAGAGGCAGGAAGG - Intronic
1166754123 19:45179948-45179970 GTCAGGTCCCAGAGGCAGCAAGG - Exonic
1166968687 19:46547420-46547442 CTGAAGGCAAAGGGGAAGCAAGG - Intronic
1168655205 19:58122540-58122562 CTTAAAGCCGAGAAGCAGCAGGG + Intergenic
925381818 2:3433461-3433483 GGGAGGGCCCAGAGGCAGCTAGG - Intronic
925930837 2:8706490-8706512 CTGGAGGCACACAGGCAGGAAGG - Intergenic
926226871 2:10973026-10973048 GTGAAGGCTCTGAGGCAGGAAGG + Intergenic
926988179 2:18646879-18646901 CTGAAGACCCAGAGAAAGAAAGG - Intergenic
927068080 2:19493799-19493821 GCAAAGGCCCAGAGGCAGGAAGG + Intergenic
927625103 2:24707871-24707893 CTGGAGGCCCAGAGCCAGGTGGG + Exonic
927689209 2:25195793-25195815 GCAAAGGCCCAGAGGCAGGAGGG - Intergenic
930034283 2:47075869-47075891 AGCAATGCCCAGAGGCAGCAGGG - Exonic
931974918 2:67632927-67632949 GTGAAGGTCCAGGGACAGCAGGG + Intergenic
932413198 2:71559221-71559243 GTGTAGCCCCAGACGCAGCACGG - Intronic
932741193 2:74292334-74292356 ATGGAGGGCCAGAGGTAGCATGG - Intronic
933762313 2:85680786-85680808 CTGGAGGCCCCAAGGCAGCCAGG - Intergenic
933810203 2:86028311-86028333 CTGAAACCCCAAAGGCAGGATGG + Intronic
934517009 2:94994557-94994579 CTGATGGTCCAGCGTCAGCACGG + Intergenic
934621117 2:95807787-95807809 GTGAAGGCCCACAGGCTGGAGGG - Intergenic
934812329 2:97291030-97291052 ATGAAGGCTCAGAGGCTGGAGGG + Intergenic
934825365 2:97416893-97416915 ATGAAGGCTCAGAGGCTGGAGGG - Intergenic
935291826 2:101617583-101617605 GGGCAGGCTCAGAGGCAGCATGG + Intergenic
935309926 2:101773375-101773397 CCGAAGGCCCAGAGGCGACCTGG + Intronic
935606218 2:104974496-104974518 TGGAAGGCACAGAGGCTGCATGG - Intergenic
935765071 2:106359008-106359030 GAGAAGGGCCAGAGGCAGGAGGG - Intergenic
936069253 2:109354289-109354311 CTGCAGGCCCAGAGGCTGAAGGG + Intronic
936160289 2:110079704-110079726 CTGATGGTCCAGTGTCAGCATGG - Intergenic
936184375 2:110291650-110291672 CTGATGGTCCAGTGTCAGCATGG + Intergenic
937260346 2:120581609-120581631 CTGAAGGCCCAGAAGCTCAAAGG + Intergenic
938406552 2:131036068-131036090 CTGCAGGCAGAGAGGCAGCCTGG + Intronic
939100788 2:137892312-137892334 CTGCAGGCCCAGAGGATGCAGGG - Intergenic
940754225 2:157663385-157663407 CTGGAAGCCCATTGGCAGCAGGG - Intergenic
941226015 2:162849117-162849139 CAGAAGGTGAAGAGGCAGCAAGG + Intergenic
942059559 2:172215658-172215680 CAGCAGGCCCAGAGCCAGTAAGG - Intergenic
942278529 2:174340298-174340320 CTGGAGGCCCAGAGGGTGCCTGG + Intergenic
943082452 2:183271496-183271518 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
944316689 2:198292380-198292402 CAGAAGGCCGAGAGGCAGACAGG - Intronic
945804524 2:214474264-214474286 CTGAAAGCAAAGAGGCAGCATGG + Intronic
945922149 2:215765983-215766005 CTGAGGGCCCAGTGGGAGCTAGG + Intergenic
946281944 2:218672094-218672116 CTGATGGCCCTGAGGCAGTTCGG + Exonic
946985626 2:225269578-225269600 CAGAAGGCGAAGAGGAAGCAAGG + Intergenic
947668114 2:231919720-231919742 CCCAAGGCCCAGAGGCAGAAGGG - Intergenic
947855329 2:233320140-233320162 CTGAAGGCTCACAGGCCACATGG - Intronic
947982497 2:234422296-234422318 CTCAAGGAACAGAGACAGCATGG - Intergenic
948124423 2:235554486-235554508 CAGCAGGCCCACATGCAGCAGGG - Intronic
1169200211 20:3705613-3705635 CTGGAGGCCCAGGAGCAGCCTGG + Intronic
1169276124 20:4234849-4234871 GCAAAGGCCCTGAGGCAGCAGGG + Intronic
1170107045 20:12763024-12763046 CAGAAGGCACAGAGACACCAGGG - Intergenic
1170445763 20:16425935-16425957 CAGAAGGCAAAGAGGAAGCAAGG + Intronic
1171012257 20:21515106-21515128 CGCAGAGCCCAGAGGCAGCAGGG - Intergenic
1171461963 20:25303037-25303059 CTGAGGCCCCACAGACAGCATGG + Intronic
1172133686 20:32673230-32673252 CTGGAGCCACAGAGGCAGGAGGG + Intergenic
1172637967 20:36422735-36422757 CTGCAGACACAGAGGCACCATGG + Intronic
1173430373 20:42982565-42982587 GTGAAGGCCCTGAGGCAGCAAGG + Intronic
1173495079 20:43513047-43513069 CTGAATCCCCAGAGGGAGGAGGG + Intronic
1174059112 20:47819876-47819898 CTGAAGGGTCCGAGGCTGCATGG - Intergenic
1174127395 20:48317053-48317075 CTGAAGCCACGGAGGAAGCATGG + Intergenic
1174309010 20:49635906-49635928 CTGAAGGCCAAGAGGCTCCAAGG + Exonic
1174386168 20:50189827-50189849 GTGGAGGCCCAGAGAGAGCATGG - Intergenic
1174407323 20:50310673-50310695 CTGGGGGCCCAGCGGCAGCCAGG + Intergenic
1175725208 20:61313293-61313315 CCGGAGACCCAGAAGCAGCAGGG + Intronic
1175797154 20:61778908-61778930 CTGAAGCCCCAGTGCCCGCATGG - Intronic
1175881020 20:62259143-62259165 CTGCAGGCCCAGAGCCCCCATGG + Intronic
1175910868 20:62404956-62404978 CTGCAGGCCCAGAGCCTCCATGG - Intronic
1176187759 20:63790675-63790697 CTCAACGAGCAGAGGCAGCACGG - Exonic
1176300150 21:5095493-5095515 CTGATCGCCCAGAGGGCGCACGG + Intergenic
1176452749 21:6878472-6878494 CTGCAGGCCCAGAGGATTCAGGG - Intergenic
1176830922 21:13743521-13743543 CTGCAGGCCCAGAGGATTCAGGG - Intergenic
1178024164 21:28446147-28446169 CGGAAGGCAAAGAGGAAGCAAGG - Intergenic
1178187832 21:30243872-30243894 CTGAAGCCCTCCAGGCAGCATGG + Intergenic
1179356324 21:40663805-40663827 CTTCAGGCCCAGAAGCATCAAGG - Intronic
1179856872 21:44166418-44166440 CTGATCGCCCAGAGGGCGCACGG - Intergenic
1179910161 21:44443212-44443234 CTTGAAGCTCAGAGGCAGCAGGG + Intergenic
1180153713 21:45966796-45966818 CTTAAGACCCACAGTCAGCAAGG - Intergenic
1180159130 21:45991258-45991280 CTGAAGGCCCTCGGGCTGCAGGG - Intronic
1180606401 22:17062105-17062127 CTGAAGTCACAGTGTCAGCACGG + Intergenic
1180926120 22:19556165-19556187 CTGCAGGGCCAGAGGCAAGATGG - Intergenic
1180978814 22:19869011-19869033 CAGGAGGCCCAGACACAGCAGGG - Intergenic
1181156698 22:20926757-20926779 CTGAAAGCCCAGGGACAGAAGGG + Intronic
1181737496 22:24893241-24893263 CTGAAGACACAAAGGGAGCAAGG - Intronic
1182108478 22:27705902-27705924 CAGAAGGCCAAGGGGAAGCAAGG + Intergenic
1182119761 22:27779104-27779126 CTCAGGGGCCAAAGGCAGCAGGG + Intronic
1182120925 22:27786187-27786209 CTGAAGGCAGAGAGACAGGAAGG + Intronic
1182556755 22:31133517-31133539 CTGAGGTCCCAAAGGCAACAAGG - Intronic
1182994139 22:34797431-34797453 AGGAAGGCCCAGAGGCAGGAAGG + Intergenic
1183355405 22:37356202-37356224 CTGAAGGACTAGAGGCTGCTGGG + Intergenic
1184235702 22:43181997-43182019 ATGAAGGCCCGGAAGCAGAAAGG + Intronic
1184391605 22:44206469-44206491 CTGGAGGGCCCGAGGCTGCAGGG + Exonic
1184757042 22:46522737-46522759 CAGAAGGGTGAGAGGCAGCAGGG + Intronic
1184803069 22:46774296-46774318 CAGGAGGCCCAGAGGGAACAGGG + Intronic
1185003297 22:48259854-48259876 CCAGAGGCCCAAAGGCAGCACGG + Intergenic
1185119318 22:48956309-48956331 CAGAAGGCCCAGATGTTGCAGGG + Intergenic
1185369520 22:50454611-50454633 CTGAACCCCCAGAGGAAGAACGG - Exonic
949102510 3:163076-163098 TTGAAGGCAGAGAGGAAGCAGGG - Intergenic
949359863 3:3220335-3220357 CAGAAGGCGAAGAGGAAGCAAGG + Intergenic
950187001 3:10951513-10951535 CAGAAGCCCCTGAGGCTGCAAGG - Intergenic
950576376 3:13834507-13834529 ATGAAGTCAAAGAGGCAGCAGGG - Intronic
950657412 3:14445125-14445147 ATGAAGGCTCTGAGGCAGCCGGG + Intronic
950668628 3:14512139-14512161 GCAAAGGCCCAGAGGCAGGAAGG + Intronic
950831275 3:15878437-15878459 CTGGAGGCCAAGATGCGGCATGG + Intergenic
950876560 3:16280015-16280037 CTGAGGTCCCAGAGCCAGTAAGG - Intronic
951097027 3:18644391-18644413 CTGAAGCCCCAGAGACAGTGGGG - Intergenic
951127603 3:19002127-19002149 CTGAAGGCACAGAAGCAAAAAGG - Intergenic
951772293 3:26272013-26272035 CTGAGGGACCAGAGACAGAAAGG - Intergenic
953442070 3:42926919-42926941 AGGAAGGCCCTGAGGCAGGAGGG + Intronic
953798178 3:46001463-46001485 CTCAAGCCCCAGAGGAACCAAGG + Intergenic
954065784 3:48104820-48104842 CTGAAGACCCACAGTCAGAAAGG + Intergenic
955317597 3:57951799-57951821 CTGGAGGGGCAGAGGCAGCCTGG - Intergenic
955391393 3:58524773-58524795 CTGAGGGCCTCGAGGCAGGACGG - Intronic
955396985 3:58564556-58564578 ATGAAGCCCCAGAGGTAGAAGGG - Intronic
956019130 3:64914858-64914880 GTGAAGGCCCTGTGGCAGAAGGG + Intergenic
956487039 3:69733850-69733872 CTGCAAGCTCAGAGGCACCAAGG - Intergenic
956969701 3:74508262-74508284 CAGAAGGCAAAGAAGCAGCAAGG - Intronic
957544864 3:81624121-81624143 CAGAAGGCAAAGAGGAAGCAAGG + Intronic
957783301 3:84848329-84848351 CTGAAGGCAAAGGGGAAGCAAGG + Intergenic
958856687 3:99393973-99393995 CTGCAGGCCCAAAGGGAACACGG + Intergenic
959814856 3:110663073-110663095 CAGAAGGCCAAGGGGAAGCAAGG - Intergenic
961312445 3:126012121-126012143 GCAAAGGCCCAGAGGCAGGAAGG - Intronic
961467151 3:127088932-127088954 GTGAGGGCCCAGAGGCCCCAGGG - Intergenic
961509755 3:127393615-127393637 GGGAAGGCCCAGAGTCAGGAAGG + Intergenic
961724708 3:128919832-128919854 CTGGAGGCCTAGAGGTACCAGGG - Intronic
961728551 3:128950182-128950204 CTGAATGCCCACAGACAGAAAGG - Intronic
961798298 3:129425467-129425489 CTGAAAACCCAGAGCCAGGAAGG - Intronic
962573639 3:136736017-136736039 TTGAAGGCCCAGATGAAACAGGG - Intronic
962835692 3:139186447-139186469 CTCCAGCCCCACAGGCAGCAGGG - Intronic
963318525 3:143786792-143786814 ATGAATGCACAGAGGAAGCATGG + Intronic
964524463 3:157603514-157603536 ATTTAGGCCCAGAGGCCGCATGG + Intronic
965051175 3:163649636-163649658 CTGAAGCCCAGGAGGCAGGAAGG - Intergenic
965624092 3:170669854-170669876 TTGCAGATCCAGAGGCAGCATGG - Intronic
965950617 3:174303795-174303817 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
967463347 3:189773809-189773831 GTGAAAGGCCAGAGACAGCATGG - Intronic
967986451 3:195098874-195098896 CGGAAAGCCCTGAGGCAGCTTGG - Intronic
968046895 3:195629530-195629552 CTGAGTGCCCAGCGTCAGCATGG + Intergenic
968307758 3:197660514-197660536 CTGAGTGCCCAGCGTCAGCATGG - Intergenic
968438726 4:610564-610586 CTGAAGGCTGTGAGGCAGCCAGG + Intergenic
968844314 4:3031454-3031476 GTGCAGGCTCAGAGCCAGCAGGG + Intronic
969295750 4:6269957-6269979 CTGCCGGCCCAGAGGCCCCAGGG + Exonic
969297631 4:6279140-6279162 CTGCATGCCCAGTGGCCGCAGGG + Intronic
969489456 4:7490857-7490879 CAGAGGGCACAGAGGAAGCAGGG - Intronic
969697152 4:8741248-8741270 CTGAAGCCGCAGAGGCATCTGGG - Intergenic
969913021 4:10462238-10462260 CTGTAGGGCCGGAGGCTGCAAGG - Intergenic
969986351 4:11215146-11215168 CAGAAGGCGAAGAGGAAGCAAGG + Intergenic
972800880 4:42474568-42474590 CTGAAGGCACAGAGCCAGGCAGG + Intronic
973026973 4:45284612-45284634 CAGAGGGCGCTGAGGCAGCAGGG + Intergenic
975095944 4:70456502-70456524 CTGAAGGCAAAGGGGAAGCAAGG + Intronic
977016238 4:91695887-91695909 CAGAAGGCAAAGAGGAAGCAGGG + Intergenic
979647524 4:123088753-123088775 CTGAAGGAGAAGAGGAAGCAAGG - Intronic
980090716 4:128440611-128440633 TTAAAGGCTCAGAGGCAGAAGGG - Intergenic
980267629 4:130539091-130539113 CTGTAGTTTCAGAGGCAGCAAGG + Intergenic
980990283 4:139733649-139733671 CTGAAGACCTACAGGCAGGAAGG + Intronic
982103446 4:151990910-151990932 TTGAATGCACAGAGACAGCAGGG - Intergenic
985617998 5:936214-936236 CTCTAAGCCCAGAGGCAGCCTGG + Intergenic
985886976 5:2687393-2687415 GTGAAGCCCCACAGCCAGCAAGG - Intergenic
986042341 5:4005656-4005678 CTGAAGGGTGGGAGGCAGCACGG - Intergenic
986736005 5:10667750-10667772 CTGAGGCCCCAGAGGGAGCATGG - Intergenic
986900326 5:12422733-12422755 CAGAAGGCAAAGCGGCAGCAAGG - Intergenic
987843224 5:23247325-23247347 CAGAAGGCGAAGAGGAAGCAAGG - Intergenic
988371254 5:30370942-30370964 GTGAAGGCCCAGAGGCTGGGAGG - Intergenic
988780517 5:34516934-34516956 CTGAAGGAAATGAGGCAGCAAGG - Intergenic
989578594 5:43011218-43011240 TTGAAATCCCAGAGACAGCAAGG + Intergenic
990205981 5:53430176-53430198 ATGAGGGGCCAGAGGCAGGAGGG - Intergenic
990266426 5:54081671-54081693 CAGAAGGCGAAGAGGAAGCAAGG - Intronic
990599831 5:57347042-57347064 CATAAGGACCATAGGCAGCATGG + Intergenic
990623636 5:57587522-57587544 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
991559141 5:67930663-67930685 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
991653802 5:68883113-68883135 GGGAAGGCCCTGAGGCAGCGGGG + Intergenic
992184578 5:74231809-74231831 CTGAAGGACAAGTAGCAGCAGGG + Intergenic
993919875 5:93788350-93788372 CGGGAGGGCCGGAGGCAGCAAGG + Intronic
995723421 5:115161459-115161481 CTGATGGCCCAAATGCTGCATGG + Intronic
997745680 5:136298308-136298330 CTGAAGGAACAGAGGCAGGCAGG + Intronic
998577229 5:143329172-143329194 CAGAAGGCAAAGAGGAAGCAAGG + Intronic
999334700 5:150705514-150705536 ATGAAGGGCCAGAGACAGGAAGG + Intergenic
999418039 5:151416992-151417014 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
999493416 5:152073638-152073660 CAGAAGGCCGGGAGGCAGCAAGG + Intergenic
1000442710 5:161282278-161282300 CTGAAAGTCCATAGGCAGCCTGG - Intergenic
1001085652 5:168698517-168698539 CTAGAGGCTCAGAGGGAGCATGG + Intronic
1001313214 5:170625728-170625750 GTCAAAACCCAGAGGCAGCAGGG + Intronic
1001419010 5:171572880-171572902 CTGCAGGTCCAGAGGAGGCATGG - Intergenic
1001956408 5:175850930-175850952 CTGAGGAACCAGAGGCAGGAGGG + Intronic
1002382220 5:178839142-178839164 CTGGAGGCCCTGAAGTAGCAAGG + Intergenic
1003285226 6:4728370-4728392 CTGAAGAGCCACATGCAGCAGGG - Intronic
1003402880 6:5805433-5805455 CAGAAGGCAAAGAGGAAGCAGGG - Intergenic
1004543462 6:16573777-16573799 TTGTAGGCACAGTGGCAGCAGGG - Intronic
1004610329 6:17233544-17233566 CTCAAAGCCCAGAGTCAGAATGG - Intergenic
1004732131 6:18368224-18368246 CTGGAGGCCAAGATGCGGCATGG - Intergenic
1005973596 6:30780254-30780276 CTGAAGGCCCAGAGTGAACAGGG - Intergenic
1006154233 6:32005687-32005709 CAGCAGGCCCAGGAGCAGCATGG - Intergenic
1006160537 6:32038421-32038443 CAGCAGGCCCAGGAGCAGCATGG - Exonic
1006365032 6:33610269-33610291 GAAAAGGCCCAGAGGCAGGAAGG - Intergenic
1006408420 6:33858119-33858141 CTGAGGGCCCACAGCCAGCCTGG + Intergenic
1006598174 6:35208734-35208756 TGGAAGGACAAGAGGCAGCAGGG + Intergenic
1007009481 6:38401292-38401314 CAGAAGGCAAAGAGGAAGCAAGG - Intronic
1007247313 6:40471898-40471920 CTGAGTGCCCAGAAGCAGCGAGG + Intronic
1008206911 6:48671479-48671501 CAGTAGACCCAGAGTCAGCAAGG + Intergenic
1008612986 6:53201458-53201480 ATGAAGGGCCAGAGACAGCAGGG - Intergenic
1009655488 6:66539716-66539738 CTAAAAGCCCAGAGTAAGCAGGG - Intergenic
1009681761 6:66902675-66902697 CTGTATGACCATAGGCAGCACGG - Intergenic
1010969994 6:82253141-82253163 CTTAAGACCCAGAGTCAGAAAGG - Intergenic
1011128293 6:84029906-84029928 CAGAAGGCCAAGAGGCAGGGAGG - Intergenic
1011956048 6:93026612-93026634 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
1012137614 6:95578039-95578061 CTCAAGGCCCAGAGGCAGTCTGG - Intronic
1012749577 6:103140528-103140550 CAGAAGGGGCCGAGGCAGCAGGG + Intergenic
1013904557 6:115199557-115199579 CTGAAGGCAAAGGGGAAGCAAGG + Intergenic
1013990819 6:116252566-116252588 ATGAAGGCCCAGAGGAAGAATGG + Exonic
1014002943 6:116385183-116385205 ATGAAGGCAGAGAGGCAGTATGG + Intronic
1015058728 6:128936092-128936114 CAGAAGGCCAAGGGGAAGCAAGG - Intronic
1017307912 6:152940542-152940564 TTCAAGGCCCAGAGGTAGGAGGG - Intergenic
1017602662 6:156100535-156100557 TCGAAGGCACAGAGGCAGGAAGG - Intergenic
1018489032 6:164272768-164272790 CTCAAGGCCCAGAGGAAGCAAGG - Intergenic
1018790245 6:167142980-167143002 CTGGGGGCCCAAAGGCAGCAAGG - Intergenic
1019070335 6:169340423-169340445 CTGGAGGCCTCGAAGCAGCAGGG - Intergenic
1019190940 6:170250261-170250283 GTCCAGGCCCAGAGGCAGGAGGG - Intergenic
1019252084 7:20890-20912 CTGAAGTGCCAGAAGCAGCGAGG - Intergenic
1019279873 7:194143-194165 CTGAAAGCCCAGCGGCAGCCTGG - Intronic
1019981080 7:4622710-4622732 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
1020607898 7:10360812-10360834 CTGAAGGCAAAGGGGAAGCAAGG - Intergenic
1021475427 7:21055767-21055789 CTGAAGAGCCAGTGACAGCAGGG - Intergenic
1021475441 7:21055878-21055900 CTGAAGAACCAGTGACAGCAGGG - Intergenic
1021553995 7:21901165-21901187 CTGAAGGTCCAGATGTAGCTGGG - Exonic
1021657588 7:22887451-22887473 CTATGGGCCCAGAGCCAGCATGG - Intergenic
1022152063 7:27618253-27618275 CTGAAATCCCACTGGCAGCATGG + Intronic
1022464884 7:30646957-30646979 CTGAATGGCCAGAGGGAGTACGG + Intergenic
1023842935 7:44106971-44106993 CTGAAGGTCTATAGGAAGCAGGG - Intronic
1024711666 7:52021869-52021891 CAGGAGGCCTAGAGGGAGCAAGG - Intergenic
1024969227 7:55053459-55053481 GAGAAGGCCCAGAGACACCAAGG - Intronic
1025070950 7:55898483-55898505 CAGAAGGCCAAGGGGAAGCAAGG + Intronic
1025225806 7:57161690-57161712 TTACAGGCCCATAGGCAGCAGGG - Intergenic
1025235794 7:57234150-57234172 CTGAAGGGTCCGAGGCCGCATGG + Intergenic
1025625143 7:63214541-63214563 CTGAAGGATCAGAGGAAGAAAGG + Intergenic
1026805713 7:73428908-73428930 ATGAAGGCACAGGTGCAGCATGG + Intergenic
1026831836 7:73615154-73615176 CTGAAGTCACACAGCCAGCAAGG + Intronic
1027659071 7:80967229-80967251 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
1029147468 7:98457163-98457185 CTGAAAGGCCAGAGGCAGAGTGG + Intergenic
1030523125 7:110622562-110622584 CTGCAAGTCCAGAGGCAGTATGG + Intergenic
1031642020 7:124176197-124176219 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
1031785358 7:126024219-126024241 CGGAAGGCAAAGAGGAAGCAAGG - Intergenic
1032019691 7:128400451-128400473 CTGGAGGCCAAGATGCGGCATGG - Exonic
1033097021 7:138441090-138441112 CTGGAGGCCAAGATGCAGCATGG + Intergenic
1033901754 7:146150992-146151014 CTGAAGGCGAAGAGGAAGCAAGG + Intronic
1034256019 7:149725024-149725046 ACGAAGGCCCCGAGGCAGCGGGG - Intronic
1034313572 7:150110728-150110750 TAGAAGGGCCAGAGCCAGCAGGG + Intergenic
1034337141 7:150330885-150330907 CTGCTGGCCCAGAGGGAGAAGGG + Exonic
1034686038 7:152972328-152972350 CTGAGAGCACAGAGGCAGGAAGG + Intergenic
1034793324 7:153990068-153990090 TAGAAGGGCCAGAGCCAGCAGGG - Intronic
1035285649 7:157804969-157804991 CTGAGAGCTCAGGGGCAGCAAGG - Intronic
1035441371 7:158904111-158904133 CTGAAACCCCGGAGTCAGCATGG - Intronic
1036448887 8:8847696-8847718 CTGAAGGTCCAGAGTGTGCAGGG - Intronic
1036575912 8:10027551-10027573 CTGAAGACCCAGAGGTACAAGGG + Intergenic
1036700094 8:11007740-11007762 GTGGAGGAACAGAGGCAGCAGGG + Intronic
1037635593 8:20698961-20698983 CAGAAGGCCAAGGGGAAGCAAGG + Intergenic
1037792592 8:21959183-21959205 CTGTAGGGCCAGGGGCATCAGGG - Intronic
1038976345 8:32700930-32700952 TTGAAGACCCAGAGGCAGGAGGG - Intronic
1041073016 8:54143577-54143599 CTGAAGGCCCACAGTCATCCAGG - Intronic
1041132708 8:54719142-54719164 CAGAGGGGCCATAGGCAGCATGG - Intergenic
1041351587 8:56952579-56952601 CTGGAGGCCCACAGGCACTAGGG + Intergenic
1041424356 8:57703486-57703508 CCAAGGGCACAGAGGCAGCAGGG + Intergenic
1041822601 8:62054738-62054760 GAGAAGGCCCAAAGGCAACAAGG + Intergenic
1042004870 8:64169237-64169259 CAGAAGGGGCCGAGGCAGCATGG - Intergenic
1042721610 8:71832786-71832808 CTGAAGACCCACAGTAAGCAGGG + Intronic
1043310011 8:78847131-78847153 CTGAAAGCCCACAGGCCCCAGGG - Intergenic
1044923489 8:97189354-97189376 CAGAAGGCCAAGGGGAAGCAAGG + Intergenic
1045230626 8:100303195-100303217 CTCAAGCCCCAGTGGGAGCACGG - Exonic
1045298132 8:100889857-100889879 ATGCAGGCCTAGAAGCAGCATGG + Intergenic
1045508827 8:102797689-102797711 CTGAAGTCCAGGTGGCAGCAGGG - Intergenic
1047433622 8:124815824-124815846 CTGAATGCTGAGAGGCACCAGGG + Intergenic
1048376637 8:133828349-133828371 CGGAAGGCACAGGGGAAGCAAGG + Intergenic
1049063601 8:140295460-140295482 CTGCTGCCCCAGAGGCAGCGTGG - Intronic
1049426470 8:142540134-142540156 CTAAATGACCAGAGGGAGCATGG - Intronic
1049798781 8:144508380-144508402 CTGAAGCCACAGACACAGCAAGG + Intergenic
1050462998 9:5893218-5893240 ATGAAAACCCAGAGGCTGCAGGG + Intronic
1050847416 9:10239819-10239841 CTGAGGGGCAAGAGGCAGGAGGG - Intronic
1051767299 9:20539481-20539503 CTGAAGGCAAAGGGGAAGCAAGG + Intronic
1052231600 9:26161033-26161055 ATGAAGGCAGAGAGGTAGCAGGG + Intergenic
1052337845 9:27337941-27337963 CTCTAGGACCACAGGCAGCATGG - Intronic
1052941412 9:34134287-34134309 CTGGAGGCCAAGATGCGGCATGG - Intergenic
1055693122 9:78855671-78855693 CTGAAGAACCAGAAGTAGCAAGG + Intergenic
1056324921 9:85469236-85469258 GTGACGGCCCAGAGGTAGCCAGG + Intergenic
1057013556 9:91630475-91630497 CTGAATGCCCAGTGGAGGCAGGG + Intronic
1057745133 9:97745363-97745385 CTAAAGGACCAGATGGAGCATGG - Intergenic
1058349994 9:104010075-104010097 CAGAAGGCCAAGGGGAAGCAAGG - Intergenic
1059445783 9:114337026-114337048 CTGGGGGCCCAGAGGCAGATGGG - Exonic
1059841506 9:118222632-118222654 CTGAGGGCATAGTGGCAGCATGG + Intergenic
1059874773 9:118621918-118621940 TTAAAGGGCCAGAGGCAGTATGG + Intergenic
1060045445 9:120336796-120336818 CTGAGGCCCCAGAGGAGGCAGGG - Intergenic
1060658289 9:125387883-125387905 GTGAAGGCCCAGAGGGGACACGG + Intergenic
1060726530 9:126009641-126009663 CTGAAGGCGAAGAGAAAGCAAGG + Intergenic
1060967467 9:127719989-127720011 CAGAAAGCCCTGAGGCAGGAGGG - Intronic
1061302049 9:129711006-129711028 CTTCAGGCACACAGGCAGCAGGG - Intronic
1061949908 9:133930377-133930399 GTGGAGGCCAGGAGGCAGCAAGG - Intronic
1062018388 9:134303870-134303892 TTGAAGGCCCAGATCCAGAAGGG - Intergenic
1062498014 9:136840679-136840701 CTGAAGGCCCAGCACCTGCAGGG - Exonic
1062527461 9:136983768-136983790 ATGAAGGTCCAGAGGGACCATGG + Intronic
1062748257 9:138231025-138231047 CTGAAGTGCCAGAAGCAGCGAGG + Intergenic
1203516432 Un_GL000213v1:6043-6065 CTGCAGGCCCAGAGGATTCAGGG + Intergenic
1185478086 X:427234-427256 CGGACGCCCCAGAGACAGCACGG + Intergenic
1185478105 X:427315-427337 CTGATGCCCCAGAGACAGGACGG + Intergenic
1185478124 X:427396-427418 CTGATGCCCCAGAGACAGGACGG + Intergenic
1185478152 X:427517-427539 CGGAGGCCCCAGAGACAGCACGG + Intergenic
1185478190 X:427677-427699 CGGACGCCCCAGAGACAGCACGG + Intergenic
1187437434 X:19285514-19285536 CAGAAGGCGAAGAGGAAGCAAGG - Intergenic
1187722804 X:22169639-22169661 CTGGAGGAACAGAGGCATCAGGG + Intronic
1188283603 X:28300899-28300921 AAGAAGGCCAAGAGGAAGCAAGG - Intergenic
1189017220 X:37296809-37296831 CAGAAGGCAAAGAGGGAGCAAGG + Intergenic
1189362047 X:40360314-40360336 CTGGAGGCCAAGATGCGGCATGG - Intergenic
1189659239 X:43279232-43279254 CTGGAGGCCAAGATGCGGCATGG - Intergenic
1190263425 X:48813958-48813980 CTGGAGGCCCAAATGGAGCATGG - Intronic
1191785931 X:64917256-64917278 CTTAAGGCCCAGAGGTAGCTTGG - Exonic
1192173692 X:68873046-68873068 CTGAGGCCCCAGAGGGAGAAAGG - Intergenic
1192197054 X:69035395-69035417 GCAAAGGCCCAGAGGCAGGAGGG - Intergenic
1194050741 X:89064849-89064871 CTGAAGGCACTGAAGCACCAGGG + Intergenic
1194092608 X:89597821-89597843 CAGAAGGCAAAGGGGCAGCAAGG + Intergenic
1195091054 X:101459383-101459405 ATGAAGGCCCACAGGCACCCAGG - Intronic
1197790512 X:130249247-130249269 CAGAAGTGGCAGAGGCAGCATGG - Intronic
1197887618 X:131234954-131234976 CTGAAGTCCAAGTGTCAGCATGG + Intergenic
1198327303 X:135586558-135586580 CTGAAGGGCGAGAGCCACCAGGG - Intergenic
1199637968 X:149831567-149831589 CTTAAGGCCCAAAGGCAGCCAGG + Intergenic
1200445255 Y:3253924-3253946 CAGAAGGCAAAGGGGCAGCAAGG + Intergenic
1201636571 Y:16129028-16129050 CTGAAGGCTTGGAGGCAGGAAGG - Intergenic
1202149034 Y:21828160-21828182 CTGCAGGTCCTGAGGCTGCATGG - Intergenic