ID: 1132559273

View in Genome Browser
Species Human (GRCh38)
Location 16:585779-585801
Sequence TGCTTCTGAGGGTGCCCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132559273_1132559284 19 Left 1132559273 16:585779-585801 CCCTCAGGGCACCCTCAGAAGCA No data
Right 1132559284 16:585821-585843 TTGGGGCCGCCCACAGAGAAGGG No data
1132559273_1132559277 0 Left 1132559273 16:585779-585801 CCCTCAGGGCACCCTCAGAAGCA No data
Right 1132559277 16:585802-585824 GACACCTTCCCTTTCAGAGTTGG No data
1132559273_1132559278 1 Left 1132559273 16:585779-585801 CCCTCAGGGCACCCTCAGAAGCA No data
Right 1132559278 16:585803-585825 ACACCTTCCCTTTCAGAGTTGGG No data
1132559273_1132559279 2 Left 1132559273 16:585779-585801 CCCTCAGGGCACCCTCAGAAGCA No data
Right 1132559279 16:585804-585826 CACCTTCCCTTTCAGAGTTGGGG No data
1132559273_1132559283 18 Left 1132559273 16:585779-585801 CCCTCAGGGCACCCTCAGAAGCA No data
Right 1132559283 16:585820-585842 GTTGGGGCCGCCCACAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132559273 Original CRISPR TGCTTCTGAGGGTGCCCTGA GGG (reversed) Intergenic