ID: 1132559949

View in Genome Browser
Species Human (GRCh38)
Location 16:589093-589115
Sequence CGACGTGCTCACTGCGGCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132559949_1132559955 1 Left 1132559949 16:589093-589115 CCGCTGCCGCAGTGAGCACGTCG No data
Right 1132559955 16:589117-589139 GCCGGGTCTTGAGCTCGCGCCGG No data
1132559949_1132559959 28 Left 1132559949 16:589093-589115 CCGCTGCCGCAGTGAGCACGTCG No data
Right 1132559959 16:589144-589166 GCTCCCCGCGTCCCGAGCTGTGG 0: 1
1: 0
2: 0
3: 10
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132559949 Original CRISPR CGACGTGCTCACTGCGGCAG CGG (reversed) Intergenic