ID: 1132559955

View in Genome Browser
Species Human (GRCh38)
Location 16:589117-589139
Sequence GCCGGGTCTTGAGCTCGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132559944_1132559955 24 Left 1132559944 16:589070-589092 CCTGGGTCCCCGTCCAGGAGGCG No data
Right 1132559955 16:589117-589139 GCCGGGTCTTGAGCTCGCGCCGG No data
1132559940_1132559955 30 Left 1132559940 16:589064-589086 CCGGGCCCTGGGTCCCCGTCCAG No data
Right 1132559955 16:589117-589139 GCCGGGTCTTGAGCTCGCGCCGG No data
1132559949_1132559955 1 Left 1132559949 16:589093-589115 CCGCTGCCGCAGTGAGCACGTCG No data
Right 1132559955 16:589117-589139 GCCGGGTCTTGAGCTCGCGCCGG No data
1132559946_1132559955 16 Left 1132559946 16:589078-589100 CCCGTCCAGGAGGCGCCGCTGCC No data
Right 1132559955 16:589117-589139 GCCGGGTCTTGAGCTCGCGCCGG No data
1132559952_1132559955 -5 Left 1132559952 16:589099-589121 CCGCAGTGAGCACGTCGGGCCGG No data
Right 1132559955 16:589117-589139 GCCGGGTCTTGAGCTCGCGCCGG No data
1132559948_1132559955 11 Left 1132559948 16:589083-589105 CCAGGAGGCGCCGCTGCCGCAGT No data
Right 1132559955 16:589117-589139 GCCGGGTCTTGAGCTCGCGCCGG No data
1132559947_1132559955 15 Left 1132559947 16:589079-589101 CCGTCCAGGAGGCGCCGCTGCCG No data
Right 1132559955 16:589117-589139 GCCGGGTCTTGAGCTCGCGCCGG No data
1132559943_1132559955 25 Left 1132559943 16:589069-589091 CCCTGGGTCCCCGTCCAGGAGGC No data
Right 1132559955 16:589117-589139 GCCGGGTCTTGAGCTCGCGCCGG No data
1132559945_1132559955 17 Left 1132559945 16:589077-589099 CCCCGTCCAGGAGGCGCCGCTGC No data
Right 1132559955 16:589117-589139 GCCGGGTCTTGAGCTCGCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132559955 Original CRISPR GCCGGGTCTTGAGCTCGCGC CGG Intergenic