ID: 1132559956

View in Genome Browser
Species Human (GRCh38)
Location 16:589118-589140
Sequence GCCGGCGCGAGCTCAAGACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132559956_1132559967 19 Left 1132559956 16:589118-589140 CCGGGTCTTGAGCTCGCGCCGGC No data
Right 1132559967 16:589160-589182 GCTGTGGCGGCCGCGTCCCCGGG 0: 1
1: 0
2: 1
3: 17
4: 252
1132559956_1132559959 3 Left 1132559956 16:589118-589140 CCGGGTCTTGAGCTCGCGCCGGC No data
Right 1132559959 16:589144-589166 GCTCCCCGCGTCCCGAGCTGTGG 0: 1
1: 0
2: 0
3: 10
4: 122
1132559956_1132559968 22 Left 1132559956 16:589118-589140 CCGGGTCTTGAGCTCGCGCCGGC No data
Right 1132559968 16:589163-589185 GTGGCGGCCGCGTCCCCGGGCGG 0: 1
1: 0
2: 2
3: 24
4: 173
1132559956_1132559969 26 Left 1132559956 16:589118-589140 CCGGGTCTTGAGCTCGCGCCGGC No data
Right 1132559969 16:589167-589189 CGGCCGCGTCCCCGGGCGGAAGG 0: 1
1: 0
2: 1
3: 15
4: 142
1132559956_1132559961 6 Left 1132559956 16:589118-589140 CCGGGTCTTGAGCTCGCGCCGGC No data
Right 1132559961 16:589147-589169 CCCCGCGTCCCGAGCTGTGGCGG 0: 1
1: 0
2: 0
3: 3
4: 91
1132559956_1132559966 18 Left 1132559956 16:589118-589140 CCGGGTCTTGAGCTCGCGCCGGC No data
Right 1132559966 16:589159-589181 AGCTGTGGCGGCCGCGTCCCCGG 0: 1
1: 0
2: 0
3: 10
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132559956 Original CRISPR GCCGGCGCGAGCTCAAGACC CGG (reversed) Intergenic