ID: 1132559958

View in Genome Browser
Species Human (GRCh38)
Location 16:589140-589162
Sequence AGCTCGGGACGCGGGGAGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 245}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132559958_1132559969 4 Left 1132559958 16:589140-589162 CCGCGCTCCCCGCGTCCCGAGCT 0: 1
1: 0
2: 1
3: 10
4: 245
Right 1132559969 16:589167-589189 CGGCCGCGTCCCCGGGCGGAAGG 0: 1
1: 0
2: 1
3: 15
4: 142
1132559958_1132559974 15 Left 1132559958 16:589140-589162 CCGCGCTCCCCGCGTCCCGAGCT 0: 1
1: 0
2: 1
3: 10
4: 245
Right 1132559974 16:589178-589200 CCGGGCGGAAGGCTCACGCTCGG 0: 1
1: 0
2: 0
3: 2
4: 68
1132559958_1132559966 -4 Left 1132559958 16:589140-589162 CCGCGCTCCCCGCGTCCCGAGCT 0: 1
1: 0
2: 1
3: 10
4: 245
Right 1132559966 16:589159-589181 AGCTGTGGCGGCCGCGTCCCCGG 0: 1
1: 0
2: 0
3: 10
4: 155
1132559958_1132559968 0 Left 1132559958 16:589140-589162 CCGCGCTCCCCGCGTCCCGAGCT 0: 1
1: 0
2: 1
3: 10
4: 245
Right 1132559968 16:589163-589185 GTGGCGGCCGCGTCCCCGGGCGG 0: 1
1: 0
2: 2
3: 24
4: 173
1132559958_1132559967 -3 Left 1132559958 16:589140-589162 CCGCGCTCCCCGCGTCCCGAGCT 0: 1
1: 0
2: 1
3: 10
4: 245
Right 1132559967 16:589160-589182 GCTGTGGCGGCCGCGTCCCCGGG 0: 1
1: 0
2: 1
3: 17
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132559958 Original CRISPR AGCTCGGGACGCGGGGAGCG CGG (reversed) Intergenic