ID: 1132559959

View in Genome Browser
Species Human (GRCh38)
Location 16:589144-589166
Sequence GCTCCCCGCGTCCCGAGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 122}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132559949_1132559959 28 Left 1132559949 16:589093-589115 CCGCTGCCGCAGTGAGCACGTCG No data
Right 1132559959 16:589144-589166 GCTCCCCGCGTCCCGAGCTGTGG 0: 1
1: 0
2: 0
3: 10
4: 122
1132559956_1132559959 3 Left 1132559956 16:589118-589140 CCGGGTCTTGAGCTCGCGCCGGC No data
Right 1132559959 16:589144-589166 GCTCCCCGCGTCCCGAGCTGTGG 0: 1
1: 0
2: 0
3: 10
4: 122
1132559952_1132559959 22 Left 1132559952 16:589099-589121 CCGCAGTGAGCACGTCGGGCCGG No data
Right 1132559959 16:589144-589166 GCTCCCCGCGTCCCGAGCTGTGG 0: 1
1: 0
2: 0
3: 10
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132559959 Original CRISPR GCTCCCCGCGTCCCGAGCTG TGG Intergenic