ID: 1132559961

View in Genome Browser
Species Human (GRCh38)
Location 16:589147-589169
Sequence CCCCGCGTCCCGAGCTGTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 91}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132559952_1132559961 25 Left 1132559952 16:589099-589121 CCGCAGTGAGCACGTCGGGCCGG No data
Right 1132559961 16:589147-589169 CCCCGCGTCCCGAGCTGTGGCGG 0: 1
1: 0
2: 0
3: 3
4: 91
1132559956_1132559961 6 Left 1132559956 16:589118-589140 CCGGGTCTTGAGCTCGCGCCGGC No data
Right 1132559961 16:589147-589169 CCCCGCGTCCCGAGCTGTGGCGG 0: 1
1: 0
2: 0
3: 3
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132559961 Original CRISPR CCCCGCGTCCCGAGCTGTGG CGG Intergenic