ID: 1132559961 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:589147-589169 |
Sequence | CCCCGCGTCCCGAGCTGTGG CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 95 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 3, 4: 91} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1132559952_1132559961 | 25 | Left | 1132559952 | 16:589099-589121 | CCGCAGTGAGCACGTCGGGCCGG | No data | ||
Right | 1132559961 | 16:589147-589169 | CCCCGCGTCCCGAGCTGTGGCGG | 0: 1 1: 0 2: 0 3: 3 4: 91 |
||||
1132559956_1132559961 | 6 | Left | 1132559956 | 16:589118-589140 | CCGGGTCTTGAGCTCGCGCCGGC | No data | ||
Right | 1132559961 | 16:589147-589169 | CCCCGCGTCCCGAGCTGTGGCGG | 0: 1 1: 0 2: 0 3: 3 4: 91 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1132559961 | Original CRISPR | CCCCGCGTCCCGAGCTGTGG CGG | Intergenic | ||