ID: 1132559966

View in Genome Browser
Species Human (GRCh38)
Location 16:589159-589181
Sequence AGCTGTGGCGGCCGCGTCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 155}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132559956_1132559966 18 Left 1132559956 16:589118-589140 CCGGGTCTTGAGCTCGCGCCGGC No data
Right 1132559966 16:589159-589181 AGCTGTGGCGGCCGCGTCCCCGG 0: 1
1: 0
2: 0
3: 10
4: 155
1132559957_1132559966 0 Left 1132559957 16:589136-589158 CCGGCCGCGCTCCCCGCGTCCCG 0: 1
1: 0
2: 7
3: 54
4: 403
Right 1132559966 16:589159-589181 AGCTGTGGCGGCCGCGTCCCCGG 0: 1
1: 0
2: 0
3: 10
4: 155
1132559958_1132559966 -4 Left 1132559958 16:589140-589162 CCGCGCTCCCCGCGTCCCGAGCT 0: 1
1: 0
2: 1
3: 10
4: 245
Right 1132559966 16:589159-589181 AGCTGTGGCGGCCGCGTCCCCGG 0: 1
1: 0
2: 0
3: 10
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132559966 Original CRISPR AGCTGTGGCGGCCGCGTCCC CGG Intergenic