ID: 1132559967

View in Genome Browser
Species Human (GRCh38)
Location 16:589160-589182
Sequence GCTGTGGCGGCCGCGTCCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 252}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132559960_1132559967 -10 Left 1132559960 16:589147-589169 CCCCGCGTCCCGAGCTGTGGCGG 0: 1
1: 0
2: 0
3: 5
4: 48
Right 1132559967 16:589160-589182 GCTGTGGCGGCCGCGTCCCCGGG 0: 1
1: 0
2: 1
3: 17
4: 252
1132559958_1132559967 -3 Left 1132559958 16:589140-589162 CCGCGCTCCCCGCGTCCCGAGCT 0: 1
1: 0
2: 1
3: 10
4: 245
Right 1132559967 16:589160-589182 GCTGTGGCGGCCGCGTCCCCGGG 0: 1
1: 0
2: 1
3: 17
4: 252
1132559957_1132559967 1 Left 1132559957 16:589136-589158 CCGGCCGCGCTCCCCGCGTCCCG 0: 1
1: 0
2: 7
3: 54
4: 403
Right 1132559967 16:589160-589182 GCTGTGGCGGCCGCGTCCCCGGG 0: 1
1: 0
2: 1
3: 17
4: 252
1132559956_1132559967 19 Left 1132559956 16:589118-589140 CCGGGTCTTGAGCTCGCGCCGGC No data
Right 1132559967 16:589160-589182 GCTGTGGCGGCCGCGTCCCCGGG 0: 1
1: 0
2: 1
3: 17
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132559967 Original CRISPR GCTGTGGCGGCCGCGTCCCC GGG Intergenic