ID: 1132559968

View in Genome Browser
Species Human (GRCh38)
Location 16:589163-589185
Sequence GTGGCGGCCGCGTCCCCGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 173}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132559957_1132559968 4 Left 1132559957 16:589136-589158 CCGGCCGCGCTCCCCGCGTCCCG 0: 1
1: 0
2: 7
3: 54
4: 403
Right 1132559968 16:589163-589185 GTGGCGGCCGCGTCCCCGGGCGG 0: 1
1: 0
2: 2
3: 24
4: 173
1132559962_1132559968 -8 Left 1132559962 16:589148-589170 CCCGCGTCCCGAGCTGTGGCGGC 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1132559968 16:589163-589185 GTGGCGGCCGCGTCCCCGGGCGG 0: 1
1: 0
2: 2
3: 24
4: 173
1132559963_1132559968 -9 Left 1132559963 16:589149-589171 CCGCGTCCCGAGCTGTGGCGGCC 0: 1
1: 0
2: 1
3: 10
4: 103
Right 1132559968 16:589163-589185 GTGGCGGCCGCGTCCCCGGGCGG 0: 1
1: 0
2: 2
3: 24
4: 173
1132559960_1132559968 -7 Left 1132559960 16:589147-589169 CCCCGCGTCCCGAGCTGTGGCGG 0: 1
1: 0
2: 0
3: 5
4: 48
Right 1132559968 16:589163-589185 GTGGCGGCCGCGTCCCCGGGCGG 0: 1
1: 0
2: 2
3: 24
4: 173
1132559956_1132559968 22 Left 1132559956 16:589118-589140 CCGGGTCTTGAGCTCGCGCCGGC No data
Right 1132559968 16:589163-589185 GTGGCGGCCGCGTCCCCGGGCGG 0: 1
1: 0
2: 2
3: 24
4: 173
1132559958_1132559968 0 Left 1132559958 16:589140-589162 CCGCGCTCCCCGCGTCCCGAGCT 0: 1
1: 0
2: 1
3: 10
4: 245
Right 1132559968 16:589163-589185 GTGGCGGCCGCGTCCCCGGGCGG 0: 1
1: 0
2: 2
3: 24
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132559968 Original CRISPR GTGGCGGCCGCGTCCCCGGG CGG Intergenic