ID: 1132559974

View in Genome Browser
Species Human (GRCh38)
Location 16:589178-589200
Sequence CCGGGCGGAAGGCTCACGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 68}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132559963_1132559974 6 Left 1132559963 16:589149-589171 CCGCGTCCCGAGCTGTGGCGGCC 0: 1
1: 0
2: 1
3: 10
4: 103
Right 1132559974 16:589178-589200 CCGGGCGGAAGGCTCACGCTCGG 0: 1
1: 0
2: 0
3: 2
4: 68
1132559958_1132559974 15 Left 1132559958 16:589140-589162 CCGCGCTCCCCGCGTCCCGAGCT 0: 1
1: 0
2: 1
3: 10
4: 245
Right 1132559974 16:589178-589200 CCGGGCGGAAGGCTCACGCTCGG 0: 1
1: 0
2: 0
3: 2
4: 68
1132559965_1132559974 -1 Left 1132559965 16:589156-589178 CCGAGCTGTGGCGGCCGCGTCCC 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1132559974 16:589178-589200 CCGGGCGGAAGGCTCACGCTCGG 0: 1
1: 0
2: 0
3: 2
4: 68
1132559962_1132559974 7 Left 1132559962 16:589148-589170 CCCGCGTCCCGAGCTGTGGCGGC 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1132559974 16:589178-589200 CCGGGCGGAAGGCTCACGCTCGG 0: 1
1: 0
2: 0
3: 2
4: 68
1132559964_1132559974 0 Left 1132559964 16:589155-589177 CCCGAGCTGTGGCGGCCGCGTCC 0: 1
1: 0
2: 1
3: 12
4: 130
Right 1132559974 16:589178-589200 CCGGGCGGAAGGCTCACGCTCGG 0: 1
1: 0
2: 0
3: 2
4: 68
1132559960_1132559974 8 Left 1132559960 16:589147-589169 CCCCGCGTCCCGAGCTGTGGCGG 0: 1
1: 0
2: 0
3: 5
4: 48
Right 1132559974 16:589178-589200 CCGGGCGGAAGGCTCACGCTCGG 0: 1
1: 0
2: 0
3: 2
4: 68
1132559957_1132559974 19 Left 1132559957 16:589136-589158 CCGGCCGCGCTCCCCGCGTCCCG 0: 1
1: 0
2: 7
3: 54
4: 403
Right 1132559974 16:589178-589200 CCGGGCGGAAGGCTCACGCTCGG 0: 1
1: 0
2: 0
3: 2
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132559974 Original CRISPR CCGGGCGGAAGGCTCACGCT CGG Intergenic