ID: 1132560446

View in Genome Browser
Species Human (GRCh38)
Location 16:590932-590954
Sequence GGTGTCATGGGTCCAGGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 2, 2: 1, 3: 8, 4: 187}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132560446 Original CRISPR GGTGTCATGGGTCCAGGATC TGG Intronic
900397311 1:2458389-2458411 TGTGTCATGGGTCCCGGCTGAGG - Intronic
900464830 1:2820606-2820628 GGGGTCGGGGGTCCAGGGTCAGG + Intergenic
901400855 1:9014372-9014394 GGTCTCCTGGGTCCAAGCTCAGG - Intronic
901462834 1:9401844-9401866 GGAGTCCTGGGTCCTGTATCAGG - Intergenic
904050312 1:27634636-27634658 GGTCTGATGGGTCCAGGAGAGGG - Intronic
906705479 1:47891904-47891926 GGTGTCAGTGGTCCAAGATGAGG + Intronic
912392976 1:109317589-109317611 GGAGGCAGGGGTGCAGGATCTGG + Intronic
912512015 1:110195945-110195967 GGTGTCCTGGGTGCAGGTCCTGG + Intronic
913689850 1:121268763-121268785 GGTGTCAAGAGTTCAGGTTCGGG + Intronic
914147751 1:145011509-145011531 GGTGTCAAGAGTTCAGGTTCAGG - Intronic
915066828 1:153231821-153231843 GGAGGCATGGTTCCAGCATCTGG - Intergenic
915120465 1:153627209-153627231 GGTGACAAGGGTCCTGGAACGGG + Intronic
918625694 1:186653740-186653762 GCTGTCATGGGTCCAGGAGCAGG + Intergenic
920090485 1:203449532-203449554 GGTGGGATGGGTCCAGGTCCGGG + Intergenic
920477173 1:206287240-206287262 GGTGTCAAGAGTTCAGGTTCGGG + Intronic
922076845 1:222253622-222253644 GGTTTTATGGGCACAGGATCAGG - Intergenic
922686530 1:227642957-227642979 GCTGTCATGGCTCCATCATCCGG + Intronic
1067068297 10:43115710-43115732 TGAGTCATGGGTCCAAGACCTGG - Intronic
1067090169 10:43262406-43262428 GGTGTCTGGGGTCCTGGACCAGG - Intronic
1067666376 10:48283119-48283141 GGTTTCATGGGCCCAGAGTCAGG - Intergenic
1067697786 10:48548184-48548206 GCTGTCACGGGGCCAGGAGCTGG - Intronic
1068089912 10:52420921-52420943 GTTGTCATGAGTCACGGATCTGG - Intergenic
1075002655 10:118809639-118809661 GGTACCATGGGTCCAAGATGAGG + Intergenic
1075082991 10:119396390-119396412 GGTTTCATGGGTCTAGGGTGGGG + Intronic
1075406682 10:122200140-122200162 TGTTTCATGGGCCCAGGACCAGG + Intronic
1075905509 10:126078323-126078345 GGGGGCATGGGACCAGGTTCAGG - Intronic
1076233103 10:128838337-128838359 GGTGTTATGGGGCCAGGAAGGGG - Intergenic
1077178082 11:1199608-1199630 GGGGACATGGGGCCAGGCTCAGG - Intronic
1079081370 11:17415592-17415614 GGTGCCATTGGTGCAGGCTCTGG + Intronic
1079162582 11:18008759-18008781 GGTGGCATGGGTGCAGGAGGAGG - Intronic
1079164671 11:18028689-18028711 GGTGTATTGGATCCAGGATTGGG - Intronic
1080767080 11:35307074-35307096 GTTGTGATGGGCCCTGGATCTGG + Intronic
1081754913 11:45537628-45537650 GATGTCATGAGGCCAGGATGGGG - Intergenic
1089114048 11:116079616-116079638 GGTGTCATGGGTGAAGAAGCAGG - Intergenic
1090137297 11:124210721-124210743 GGTGACATGGGGCCAGGGTCAGG + Intergenic
1091687044 12:2570274-2570296 GGTGTCTTCAGTTCAGGATCTGG + Intronic
1096676215 12:53227490-53227512 GGTGCCCTGGGGCCTGGATCTGG - Exonic
1097503734 12:60438562-60438584 GTTTTTATGGGTACAGGATCGGG + Intergenic
1098983426 12:76984774-76984796 GGGGTCAGGGGTCGAGGTTCAGG - Intergenic
1100608077 12:96168298-96168320 GGTGTCATGGGAAAAGGAGCAGG - Intergenic
1101408592 12:104451307-104451329 GGTTGCCTGGGTCCAGGGTCTGG + Intergenic
1101709425 12:107250894-107250916 GGAGTCATGGGGCCATGATGGGG + Intergenic
1104787572 12:131459461-131459483 GGTGTCATGAGTCCAGCCACAGG + Intergenic
1104862229 12:131929671-131929693 GGGGTCAGGGGTCGGGGATCAGG + Exonic
1104988061 12:132608445-132608467 GGGGTCAGGGCTCCAGGATCAGG - Intronic
1107163500 13:37259145-37259167 GGTGTCAGGAGTCCAGACTCAGG - Intergenic
1108518549 13:51224034-51224056 GGTGACATCGCCCCAGGATCTGG + Intronic
1110326041 13:74216512-74216534 GGTGTCCTGGGTGAAGGACCAGG + Intergenic
1116713510 14:48398709-48398731 GGGCTCATGGATGCAGGATCTGG + Intergenic
1118858548 14:69643544-69643566 GGTTTAATGGGACCATGATCAGG - Intronic
1121333900 14:93064987-93065009 GGGGTCATGGGGCTAGGGTCAGG + Intronic
1122786404 14:104166174-104166196 GGTGGCAGGGGCCCAGGAGCTGG + Intronic
1122802174 14:104236899-104236921 GGTGGCATGGGTGCAGGTTCTGG + Intergenic
1123143442 14:106105586-106105608 GGAGCCATGGGTGCAGGAGCTGG - Intergenic
1123191546 14:106576583-106576605 GGAGCCATGGGTGCAGGAGCTGG - Intergenic
1125195017 15:37035822-37035844 AGTGTCATGGGTCCAGGACAAGG - Intronic
1125841150 15:42802243-42802265 GGTGGCCTGGGTGCAGGATATGG - Intronic
1131308951 15:91270489-91270511 GTTGTCAAGAGTCCAAGATCTGG - Intronic
1132294848 15:100727419-100727441 GGTGTCAGGGGACCAGGGCCAGG + Intergenic
1132560386 16:590720-590742 GGTGTCATGGGTCCGGGATCTGG + Intronic
1132560396 16:590755-590777 GGTGTCATGGGTCCTAGAGAAGG + Intronic
1132560432 16:590876-590898 GGTGTCATGGGTGCAGGATCTGG + Intronic
1132560446 16:590932-590954 GGTGTCATGGGTCCAGGATCTGG + Intronic
1132759591 16:1502253-1502275 GCTCTCATGGGTTCAGGGTCAGG + Intronic
1133215684 16:4290980-4291002 GGTGTCAGGGGTCTTAGATCTGG - Intergenic
1134238764 16:12488446-12488468 GGTGTCATGGGTGCGGGGACGGG - Intronic
1137433266 16:48435406-48435428 GGTGGCAAGGGTCCAGGAACAGG - Intronic
1139571220 16:67813895-67813917 AGGGTCTGGGGTCCAGGATCTGG - Intronic
1139752855 16:69119884-69119906 GGTCCCATGGGCCCTGGATCTGG - Exonic
1140975911 16:80060028-80060050 GGTGTCAGATGTCCAGGATTTGG + Intergenic
1143023868 17:3929876-3929898 AGGGTCAAGGGTCCAGGATTGGG - Intronic
1143023937 17:3930110-3930132 AGGGTCAGGGGTCCAGGATTGGG - Intronic
1143299788 17:5900833-5900855 GGCTTCATGGGGTCAGGATCAGG + Intronic
1143591275 17:7886820-7886842 GGTGGTGTGGGTCCCGGATCTGG + Intronic
1143873828 17:9976732-9976754 GGAAACATGGGTTCAGGATCTGG - Intronic
1145278394 17:21450571-21450593 GCTGTCAGTGGCCCAGGATCTGG + Intergenic
1146301704 17:31694660-31694682 GGTGGCAAGGACCCAGGATCTGG + Intergenic
1146463478 17:33066536-33066558 AGCGTCATGGAACCAGGATCAGG + Intronic
1146675106 17:34767944-34767966 GGTGCCAGGGGTCCAGAGTCAGG - Intergenic
1147306574 17:39568445-39568467 GGTATCTAGGGTCCTGGATCTGG + Intergenic
1147987188 17:44313358-44313380 GGACTCATGTGTCCAGCATCAGG - Intronic
1152258561 17:79254403-79254425 GGTGCCATGTGTCCTGGATTGGG - Intronic
1154334528 18:13455135-13455157 GGTGTCCTGGCACCAGGACCAGG + Intronic
1156271391 18:35536307-35536329 GGTGTCATGGGAGTAGGATGGGG + Intergenic
1157189863 18:45571988-45572010 GGTTTAATTGGTCCAGGATGGGG - Intronic
1159082548 18:63752220-63752242 GGTCACATGGGTCCAAGATGGGG + Intergenic
1160580121 18:79879012-79879034 GGCGGCATGGGGCCAGGAGCTGG - Intronic
1161347277 19:3774673-3774695 GGTGGCTTCGGCCCAGGATCTGG + Intergenic
1161775395 19:6259332-6259354 TGTGTCATGGCTGCAGGATTTGG - Intronic
1161805672 19:6441787-6441809 GGAGTCTAGGATCCAGGATCTGG + Exonic
1161805687 19:6441845-6441867 GGAGTCTAGGATCCAGGATCTGG + Exonic
1162441510 19:10695299-10695321 GAGGTCCTGGGTCCAGGATACGG - Intergenic
1162558539 19:11402424-11402446 GGGGTCAGGGGTCAAGGGTCAGG + Intronic
1163725641 19:18921739-18921761 GGTGGCATGGGTACGGGAGCTGG + Exonic
1164722329 19:30441471-30441493 GGTGTCATGAGTCCTGGGGCTGG + Intronic
1165389467 19:35529978-35530000 GGAGTCAAGTGTCCAGGAGCTGG - Intergenic
1167358034 19:49016015-49016037 GGTGTCAGGGCTCCAGGAGTCGG + Exonic
1168723909 19:58570415-58570437 GGTGTCTTGGGCCCAGGCTCTGG + Exonic
925591035 2:5509352-5509374 GGAGTCATGGGTCCGTGATGTGG + Intergenic
926006326 2:9375982-9376004 GGTGGCATGTGTCCAGATTCTGG + Intronic
928044122 2:27910258-27910280 AATGTCATGGTTCCAGGTTCAGG + Intronic
928123906 2:28603070-28603092 GGAGTCATGGCTCCAGCCTCTGG - Intronic
929081569 2:38127460-38127482 GGTTTCATGGGGCCAGGCCCAGG + Intergenic
935115843 2:100135615-100135637 GATGTCATGGGTCATGAATCTGG - Intronic
939091219 2:137781958-137781980 GGTGGCATGGGTTCAAGTTCTGG + Intergenic
940202254 2:151164569-151164591 GGTGTCCTGATTCCAGCATCTGG + Intergenic
940839090 2:158558791-158558813 GGTGTCATGGGTACAGGGAGTGG + Intronic
941763543 2:169271011-169271033 GATGTCATGGTTCCAGTTTCGGG - Exonic
942105469 2:172629331-172629353 GTTTTCATGGGTACAGGATGGGG - Intergenic
946309010 2:218872548-218872570 GGTGTGATGGTTCCAGGAGGGGG + Intronic
948931139 2:241133206-241133228 GGTGTCCTGGGCCAAGGAGCAGG - Intronic
1171089065 20:22267191-22267213 GGTGTGGTGGGTTTAGGATCTGG - Intergenic
1172520527 20:35562724-35562746 GGGGCCCAGGGTCCAGGATCAGG + Intergenic
1173450845 20:43162653-43162675 GGAGTCAAGCTTCCAGGATCTGG + Intronic
1174307798 20:49626860-49626882 GGTGGCATGGGGACAGGCTCAGG - Intergenic
1176084843 20:63291181-63291203 GGTGTCAGGAGTCCAGGAGCAGG + Intergenic
1176278357 20:64286958-64286980 GGGGTCAGGGGTCAAGGGTCGGG + Intronic
1178005846 21:28218995-28219017 GGTTTCATGGGTCCAGCAATCGG - Intergenic
1180009549 21:45040512-45040534 GGGGCCATGGGTCCAGGACAGGG - Intergenic
1180950977 22:19720462-19720484 GCTGTCCTGGGGCCAGGCTCGGG + Intronic
1181024012 22:20117489-20117511 GGGGTCAGGGGTCGAGGTTCGGG + Intronic
1181490003 22:23255760-23255782 GGGGTCGGGGGACCAGGATCTGG - Intronic
1181668932 22:24416808-24416830 AGTCTCATGGGTCCAGCATCAGG + Exonic
1184329176 22:43815286-43815308 GGAGTCATGAGTCCAGGCCCAGG + Intergenic
1184960405 22:47924417-47924439 GGACTCATGGGGCCAGGAACAGG - Intergenic
950685858 3:14618260-14618282 GGGGAGATGGGTACAGGATCTGG + Intergenic
951165436 3:19480181-19480203 GGTTTCATAGGTCCAGGCTGTGG + Intronic
953836827 3:46353656-46353678 GGTATCATGGATTCAGAATCTGG - Intergenic
954286880 3:49625522-49625544 TGTGTCCTGGTTCCAGGATGTGG + Intronic
956410545 3:68974002-68974024 GGTGTAAGGGGTCCAGGCTTGGG - Intergenic
959689008 3:109178421-109178443 GATGACCTGGCTCCAGGATCAGG + Intergenic
962394309 3:135001448-135001470 GTGGTCATGGGTCCAGCAGCAGG - Intronic
962441028 3:135416263-135416285 GGGGCCCTGGGGCCAGGATCTGG + Intergenic
964669436 3:159209122-159209144 GTTTTTATGGGTACAGGATCAGG - Intronic
965406277 3:168273590-168273612 GGTAGGATGGGTCCAGGGTCCGG + Intergenic
967409801 3:189155571-189155593 AGTGTCAAGGGTCAAGGATATGG + Intronic
969972864 4:11066230-11066252 GGGGTCAGGGGTCAGGGATCAGG + Intergenic
970536704 4:17037432-17037454 GGGGTCATGGGGGCAGGAGCTGG + Intergenic
975847747 4:78542766-78542788 GGTGTCATGGGTGAATGATGGGG + Intronic
976720948 4:88168105-88168127 GGTGTTCTGGCTCCAGCATCTGG - Intronic
979728368 4:123992060-123992082 GTTTTTATGGGTACAGGATCGGG - Intergenic
982228043 4:153183545-153183567 GGTGCTATGGGACCAGGTTCTGG + Intronic
984966424 4:185143757-185143779 GCTGTCACGGGCGCAGGATCTGG - Intronic
986733777 5:10653473-10653495 GGTGTCATGGGGTCAGTGTCAGG + Intergenic
988684923 5:33516889-33516911 TGAGTCATGAGTCCAGGGTCCGG - Intergenic
994245669 5:97472256-97472278 AGTGACATGGGGCCAGGGTCTGG + Intergenic
999323592 5:150629563-150629585 GGTGTCAAGGGTCAAGGAAGGGG + Intronic
1002442545 5:179271961-179271983 GGAGTCTGGGGCCCAGGATCGGG - Intronic
1003823547 6:9927284-9927306 GGTGTCATCAGTCCAGGGGCAGG - Intronic
1010147338 6:72685468-72685490 GTTGTCAGGGGGCCAGGAACGGG - Intronic
1014335008 6:120122487-120122509 TGTTTCATTTGTCCAGGATCAGG - Intergenic
1017392943 6:153960662-153960684 GGTTTGATGGGTCCAGGAAAGGG + Intergenic
1018261662 6:161976420-161976442 TGTGTGATGGGCCCAGGCTCAGG + Intronic
1018804314 6:167247106-167247128 GGTGTCTTGGCTCCAGGCTGTGG - Intergenic
1025887075 7:65606295-65606317 GGAGACATGGGTACAGGAACTGG - Intergenic
1027708487 7:81566983-81567005 GGGGTTATGGGTACAGGATGGGG - Intergenic
1029137428 7:98383823-98383845 TGTTTCCTGGGTCCAGGATGGGG - Intronic
1031855340 7:126915633-126915655 GGAGACATGGGTACAGGAACTGG + Intronic
1034387119 7:150749133-150749155 ATTGTCATGGGTCCAGGTTAGGG + Intronic
1034440172 7:151082192-151082214 GGTGTCGTGGGGCCAGGCCCTGG + Exonic
1034912494 7:155008776-155008798 GGTGTCAGGAGACCAGGTTCTGG - Intergenic
1040725240 8:50374972-50374994 GGTGTAATGTGTCCTGGATAAGG + Intronic
1042874524 8:73428765-73428787 GGTGCCATGGGTCCTGGACTGGG - Intronic
1046395576 8:113633990-113634012 AGTGACATGGGGCCAGGGTCTGG + Intergenic
1048909526 8:139121631-139121653 GGTGTCATTGTTCCAGGAGGAGG + Intergenic
1048956942 8:139544986-139545008 GTTGTCATAGGTCCAGGAATTGG - Intergenic
1049301241 8:141871912-141871934 GGTGTGATGGGCACAGGGTCAGG + Intergenic
1049301369 8:141872410-141872432 GGTGTGATGGGCACAGGGTCAGG + Intergenic
1049301399 8:141872523-141872545 GGTGTGATGGGCACAGGGTCAGG + Intergenic
1049301411 8:141872576-141872598 GGTGTGATGGGCACAGGGTCAGG + Intergenic
1049731348 8:144180162-144180184 GGTGTTTTGGGTTCAGGACCTGG + Exonic
1053514095 9:38715218-38715240 TGTGTCATGTGTCCAGGACTAGG + Intergenic
1061296395 9:129679155-129679177 GGTGTCAGGGACCCAGGACCAGG + Intronic
1061753388 9:132796164-132796186 GGTGTTATGGGCCGGGGATCAGG - Intronic
1061872974 9:133530427-133530449 CCTGTCATTGGTCCAGGATGGGG - Intergenic
1203664579 Un_KI270754v1:13945-13967 TGTGTCCTGGGTCCTGTATCAGG + Intergenic
1186613226 X:11159176-11159198 GGGGTCATAGGGCCAGGACCAGG + Intronic
1188094164 X:26002131-26002153 GGAGTCATGGGTGCAGAAACTGG + Intergenic
1188884266 X:35531083-35531105 GGTGGCATGGGTTCAGGAGTGGG - Intergenic
1189794529 X:44634213-44634235 GGTCCCATGGGCCCTGGATCTGG + Intergenic
1190213637 X:48466649-48466671 GGGGTGCTGGGTCCGGGATCTGG + Intronic
1197913723 X:131513370-131513392 GGTGCAATGGGCCCAGGATGGGG + Intergenic
1200684494 Y:6246560-6246582 GGGGTCATGGGCCCAGGGCCAGG - Exonic
1200690643 Y:6304771-6304793 GGGGTCATGGGCCCAGGGCCAGG + Intergenic
1200714388 Y:6520735-6520757 GGGGTCATGGGCCCAGGGCCAGG - Intergenic
1200985788 Y:9303045-9303067 GGTGTGCTGGGGCCAGGACCAGG - Intergenic
1200990023 Y:9337819-9337841 GGGGTCATGGGCCCAGGGCCAGG - Exonic
1200992685 Y:9358134-9358156 GGGGTCATGGGCCCAGGGCCAGG - Exonic
1200995339 Y:9378413-9378435 GGGGTCATGGGCCCAGGGCCAGG - Intronic
1200998003 Y:9398758-9398780 GGGGTCATGGGCCCAGGGCCAGG - Exonic
1201000512 Y:9467292-9467314 GGGGTCATGGGCCCAGGGCCAGG - Exonic
1201003180 Y:9487622-9487644 GGGGTCATGGGCCCAGGGCCAGG - Exonic
1201005837 Y:9507904-9507926 GGGGTCATGGGCCCAGGGCCAGG - Intergenic
1201008493 Y:9528217-9528239 GGGGTCATGGGCCCAGGGCCAGG - Exonic
1201011077 Y:9548386-9548408 GGGGTCATGGGCCCAGGGCCAGG - Intergenic
1201019435 Y:9640421-9640443 GGGGTCATGGGCCCAGGGCCAGG + Intergenic
1201044629 Y:9869945-9869967 GGGGTCATGGGCCCAGGGCCAGG - Intergenic
1201063472 Y:10068829-10068851 GGGGTCATGGGCCCAGGGCCAGG + Intergenic
1202115550 Y:21466941-21466963 GGTGTGCTGGGTCCAGGGCCAGG + Intergenic