ID: 1132566995

View in Genome Browser
Species Human (GRCh38)
Location 16:628119-628141
Sequence CTGTCTGCTCCCCCGGCCTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 426
Summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 383}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132566995_1132567011 29 Left 1132566995 16:628119-628141 CCAGAGGCCGGGGGAGCAGACAG 0: 1
1: 0
2: 4
3: 38
4: 383
Right 1132567011 16:628171-628193 ACCGGGGCCCTGGCTCCCACGGG 0: 1
1: 0
2: 0
3: 22
4: 237
1132566995_1132567000 -5 Left 1132566995 16:628119-628141 CCAGAGGCCGGGGGAGCAGACAG 0: 1
1: 0
2: 4
3: 38
4: 383
Right 1132567000 16:628137-628159 GACAGGGCCGGTGCTCCCTCTGG 0: 1
1: 0
2: 2
3: 9
4: 145
1132566995_1132567010 28 Left 1132566995 16:628119-628141 CCAGAGGCCGGGGGAGCAGACAG 0: 1
1: 0
2: 4
3: 38
4: 383
Right 1132567010 16:628170-628192 GACCGGGGCCCTGGCTCCCACGG 0: 1
1: 0
2: 3
3: 17
4: 229
1132566995_1132567006 11 Left 1132566995 16:628119-628141 CCAGAGGCCGGGGGAGCAGACAG 0: 1
1: 0
2: 4
3: 38
4: 383
Right 1132567006 16:628153-628175 CCTCTGGAAGCTTGGGTGACCGG 0: 1
1: 0
2: 0
3: 20
4: 225
1132566995_1132567003 4 Left 1132566995 16:628119-628141 CCAGAGGCCGGGGGAGCAGACAG 0: 1
1: 0
2: 4
3: 38
4: 383
Right 1132567003 16:628146-628168 GGTGCTCCCTCTGGAAGCTTGGG 0: 1
1: 0
2: 2
3: 23
4: 216
1132566995_1132567002 3 Left 1132566995 16:628119-628141 CCAGAGGCCGGGGGAGCAGACAG 0: 1
1: 0
2: 4
3: 38
4: 383
Right 1132567002 16:628145-628167 CGGTGCTCCCTCTGGAAGCTTGG 0: 1
1: 0
2: 1
3: 12
4: 135
1132566995_1132567008 13 Left 1132566995 16:628119-628141 CCAGAGGCCGGGGGAGCAGACAG 0: 1
1: 0
2: 4
3: 38
4: 383
Right 1132567008 16:628155-628177 TCTGGAAGCTTGGGTGACCGGGG 0: 1
1: 0
2: 0
3: 6
4: 122
1132566995_1132567007 12 Left 1132566995 16:628119-628141 CCAGAGGCCGGGGGAGCAGACAG 0: 1
1: 0
2: 4
3: 38
4: 383
Right 1132567007 16:628154-628176 CTCTGGAAGCTTGGGTGACCGGG 0: 1
1: 0
2: 0
3: 9
4: 184
1132566995_1132567009 19 Left 1132566995 16:628119-628141 CCAGAGGCCGGGGGAGCAGACAG 0: 1
1: 0
2: 4
3: 38
4: 383
Right 1132567009 16:628161-628183 AGCTTGGGTGACCGGGGCCCTGG 0: 1
1: 0
2: 3
3: 10
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132566995 Original CRISPR CTGTCTGCTCCCCCGGCCTC TGG (reversed) Exonic