ID: 1132566999

View in Genome Browser
Species Human (GRCh38)
Location 16:628126-628148
Sequence ACCGGCCCTGTCTGCTCCCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 210}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132566999_1132567008 6 Left 1132566999 16:628126-628148 CCGGGGGAGCAGACAGGGCCGGT 0: 1
1: 0
2: 2
3: 20
4: 210
Right 1132567008 16:628155-628177 TCTGGAAGCTTGGGTGACCGGGG 0: 1
1: 0
2: 0
3: 6
4: 122
1132566999_1132567006 4 Left 1132566999 16:628126-628148 CCGGGGGAGCAGACAGGGCCGGT 0: 1
1: 0
2: 2
3: 20
4: 210
Right 1132567006 16:628153-628175 CCTCTGGAAGCTTGGGTGACCGG 0: 1
1: 0
2: 0
3: 20
4: 225
1132566999_1132567013 26 Left 1132566999 16:628126-628148 CCGGGGGAGCAGACAGGGCCGGT 0: 1
1: 0
2: 2
3: 20
4: 210
Right 1132567013 16:628175-628197 GGGCCCTGGCTCCCACGGGATGG 0: 1
1: 1
2: 3
3: 30
4: 224
1132566999_1132567007 5 Left 1132566999 16:628126-628148 CCGGGGGAGCAGACAGGGCCGGT 0: 1
1: 0
2: 2
3: 20
4: 210
Right 1132567007 16:628154-628176 CTCTGGAAGCTTGGGTGACCGGG 0: 1
1: 0
2: 0
3: 9
4: 184
1132566999_1132567017 30 Left 1132566999 16:628126-628148 CCGGGGGAGCAGACAGGGCCGGT 0: 1
1: 0
2: 2
3: 20
4: 210
Right 1132567017 16:628179-628201 CCTGGCTCCCACGGGATGGAGGG 0: 1
1: 0
2: 4
3: 23
4: 165
1132566999_1132567011 22 Left 1132566999 16:628126-628148 CCGGGGGAGCAGACAGGGCCGGT 0: 1
1: 0
2: 2
3: 20
4: 210
Right 1132567011 16:628171-628193 ACCGGGGCCCTGGCTCCCACGGG 0: 1
1: 0
2: 0
3: 22
4: 237
1132566999_1132567010 21 Left 1132566999 16:628126-628148 CCGGGGGAGCAGACAGGGCCGGT 0: 1
1: 0
2: 2
3: 20
4: 210
Right 1132567010 16:628170-628192 GACCGGGGCCCTGGCTCCCACGG 0: 1
1: 0
2: 3
3: 17
4: 229
1132566999_1132567002 -4 Left 1132566999 16:628126-628148 CCGGGGGAGCAGACAGGGCCGGT 0: 1
1: 0
2: 2
3: 20
4: 210
Right 1132567002 16:628145-628167 CGGTGCTCCCTCTGGAAGCTTGG 0: 1
1: 0
2: 1
3: 12
4: 135
1132566999_1132567009 12 Left 1132566999 16:628126-628148 CCGGGGGAGCAGACAGGGCCGGT 0: 1
1: 0
2: 2
3: 20
4: 210
Right 1132567009 16:628161-628183 AGCTTGGGTGACCGGGGCCCTGG 0: 1
1: 0
2: 3
3: 10
4: 175
1132566999_1132567015 29 Left 1132566999 16:628126-628148 CCGGGGGAGCAGACAGGGCCGGT 0: 1
1: 0
2: 2
3: 20
4: 210
Right 1132567015 16:628178-628200 CCCTGGCTCCCACGGGATGGAGG 0: 1
1: 1
2: 2
3: 21
4: 224
1132566999_1132567003 -3 Left 1132566999 16:628126-628148 CCGGGGGAGCAGACAGGGCCGGT 0: 1
1: 0
2: 2
3: 20
4: 210
Right 1132567003 16:628146-628168 GGTGCTCCCTCTGGAAGCTTGGG 0: 1
1: 0
2: 2
3: 23
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132566999 Original CRISPR ACCGGCCCTGTCTGCTCCCC CGG (reversed) Exonic