ID: 1132567001

View in Genome Browser
Species Human (GRCh38)
Location 16:628144-628166
Sequence CAAGCTTCCAGAGGGAGCAC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 302}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132567001_1132567009 -6 Left 1132567001 16:628144-628166 CCGGTGCTCCCTCTGGAAGCTTG 0: 1
1: 0
2: 1
3: 21
4: 302
Right 1132567009 16:628161-628183 AGCTTGGGTGACCGGGGCCCTGG 0: 1
1: 0
2: 3
3: 10
4: 175
1132567001_1132567011 4 Left 1132567001 16:628144-628166 CCGGTGCTCCCTCTGGAAGCTTG 0: 1
1: 0
2: 1
3: 21
4: 302
Right 1132567011 16:628171-628193 ACCGGGGCCCTGGCTCCCACGGG 0: 1
1: 0
2: 0
3: 22
4: 237
1132567001_1132567017 12 Left 1132567001 16:628144-628166 CCGGTGCTCCCTCTGGAAGCTTG 0: 1
1: 0
2: 1
3: 21
4: 302
Right 1132567017 16:628179-628201 CCTGGCTCCCACGGGATGGAGGG 0: 1
1: 0
2: 4
3: 23
4: 165
1132567001_1132567018 17 Left 1132567001 16:628144-628166 CCGGTGCTCCCTCTGGAAGCTTG 0: 1
1: 0
2: 1
3: 21
4: 302
Right 1132567018 16:628184-628206 CTCCCACGGGATGGAGGGTGTGG 0: 1
1: 0
2: 1
3: 26
4: 270
1132567001_1132567013 8 Left 1132567001 16:628144-628166 CCGGTGCTCCCTCTGGAAGCTTG 0: 1
1: 0
2: 1
3: 21
4: 302
Right 1132567013 16:628175-628197 GGGCCCTGGCTCCCACGGGATGG 0: 1
1: 1
2: 3
3: 30
4: 224
1132567001_1132567010 3 Left 1132567001 16:628144-628166 CCGGTGCTCCCTCTGGAAGCTTG 0: 1
1: 0
2: 1
3: 21
4: 302
Right 1132567010 16:628170-628192 GACCGGGGCCCTGGCTCCCACGG 0: 1
1: 0
2: 3
3: 17
4: 229
1132567001_1132567015 11 Left 1132567001 16:628144-628166 CCGGTGCTCCCTCTGGAAGCTTG 0: 1
1: 0
2: 1
3: 21
4: 302
Right 1132567015 16:628178-628200 CCCTGGCTCCCACGGGATGGAGG 0: 1
1: 1
2: 2
3: 21
4: 224
1132567001_1132567021 25 Left 1132567001 16:628144-628166 CCGGTGCTCCCTCTGGAAGCTTG 0: 1
1: 0
2: 1
3: 21
4: 302
Right 1132567021 16:628192-628214 GGATGGAGGGTGTGGTCCTGTGG 0: 1
1: 2
2: 5
3: 52
4: 384

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132567001 Original CRISPR CAAGCTTCCAGAGGGAGCAC CGG (reversed) Exonic