ID: 1132567005

View in Genome Browser
Species Human (GRCh38)
Location 16:628153-628175
Sequence CCGGTCACCCAAGCTTCCAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 101}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132567005_1132567010 -6 Left 1132567005 16:628153-628175 CCTCTGGAAGCTTGGGTGACCGG 0: 1
1: 0
2: 0
3: 3
4: 101
Right 1132567010 16:628170-628192 GACCGGGGCCCTGGCTCCCACGG 0: 1
1: 0
2: 3
3: 17
4: 229
1132567005_1132567013 -1 Left 1132567005 16:628153-628175 CCTCTGGAAGCTTGGGTGACCGG 0: 1
1: 0
2: 0
3: 3
4: 101
Right 1132567013 16:628175-628197 GGGCCCTGGCTCCCACGGGATGG 0: 1
1: 1
2: 3
3: 30
4: 224
1132567005_1132567018 8 Left 1132567005 16:628153-628175 CCTCTGGAAGCTTGGGTGACCGG 0: 1
1: 0
2: 0
3: 3
4: 101
Right 1132567018 16:628184-628206 CTCCCACGGGATGGAGGGTGTGG 0: 1
1: 0
2: 1
3: 26
4: 270
1132567005_1132567015 2 Left 1132567005 16:628153-628175 CCTCTGGAAGCTTGGGTGACCGG 0: 1
1: 0
2: 0
3: 3
4: 101
Right 1132567015 16:628178-628200 CCCTGGCTCCCACGGGATGGAGG 0: 1
1: 1
2: 2
3: 21
4: 224
1132567005_1132567011 -5 Left 1132567005 16:628153-628175 CCTCTGGAAGCTTGGGTGACCGG 0: 1
1: 0
2: 0
3: 3
4: 101
Right 1132567011 16:628171-628193 ACCGGGGCCCTGGCTCCCACGGG 0: 1
1: 0
2: 0
3: 22
4: 237
1132567005_1132567021 16 Left 1132567005 16:628153-628175 CCTCTGGAAGCTTGGGTGACCGG 0: 1
1: 0
2: 0
3: 3
4: 101
Right 1132567021 16:628192-628214 GGATGGAGGGTGTGGTCCTGTGG 0: 1
1: 2
2: 5
3: 52
4: 384
1132567005_1132567017 3 Left 1132567005 16:628153-628175 CCTCTGGAAGCTTGGGTGACCGG 0: 1
1: 0
2: 0
3: 3
4: 101
Right 1132567017 16:628179-628201 CCTGGCTCCCACGGGATGGAGGG 0: 1
1: 0
2: 4
3: 23
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132567005 Original CRISPR CCGGTCACCCAAGCTTCCAG AGG (reversed) Exonic